ID: 1062450129

View in Genome Browser
Species Human (GRCh38)
Location 9:136611705-136611727
Sequence GTGGCAATGTGAGTGGGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450129_1062450145 28 Left 1062450129 9:136611705-136611727 CCGGTCCCCACTCACATTGCCAC No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data
1062450129_1062450143 26 Left 1062450129 9:136611705-136611727 CCGGTCCCCACTCACATTGCCAC No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG No data
1062450129_1062450138 4 Left 1062450129 9:136611705-136611727 CCGGTCCCCACTCACATTGCCAC No data
Right 1062450138 9:136611732-136611754 CTCCGGTGTGGCTGCGAAGTCGG No data
1062450129_1062450142 11 Left 1062450129 9:136611705-136611727 CCGGTCCCCACTCACATTGCCAC No data
Right 1062450142 9:136611739-136611761 GTGGCTGCGAAGTCGGAGGGAGG No data
1062450129_1062450141 8 Left 1062450129 9:136611705-136611727 CCGGTCCCCACTCACATTGCCAC No data
Right 1062450141 9:136611736-136611758 GGTGTGGCTGCGAAGTCGGAGGG No data
1062450129_1062450140 7 Left 1062450129 9:136611705-136611727 CCGGTCCCCACTCACATTGCCAC No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data
1062450129_1062450144 27 Left 1062450129 9:136611705-136611727 CCGGTCCCCACTCACATTGCCAC No data
Right 1062450144 9:136611755-136611777 AGGGAGGAGAGAGCCAGCCAGGG No data
1062450129_1062450134 -8 Left 1062450129 9:136611705-136611727 CCGGTCCCCACTCACATTGCCAC No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450129 Original CRISPR GTGGCAATGTGAGTGGGGAC CGG (reversed) Intergenic
No off target data available for this crispr