ID: 1062450132

View in Genome Browser
Species Human (GRCh38)
Location 9:136611712-136611734
Sequence GAGGCAGGTGGCAATGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450132_1062450138 -3 Left 1062450132 9:136611712-136611734 CCACTCACATTGCCACCTGCCTC No data
Right 1062450138 9:136611732-136611754 CTCCGGTGTGGCTGCGAAGTCGG No data
1062450132_1062450141 1 Left 1062450132 9:136611712-136611734 CCACTCACATTGCCACCTGCCTC No data
Right 1062450141 9:136611736-136611758 GGTGTGGCTGCGAAGTCGGAGGG No data
1062450132_1062450142 4 Left 1062450132 9:136611712-136611734 CCACTCACATTGCCACCTGCCTC No data
Right 1062450142 9:136611739-136611761 GTGGCTGCGAAGTCGGAGGGAGG No data
1062450132_1062450144 20 Left 1062450132 9:136611712-136611734 CCACTCACATTGCCACCTGCCTC No data
Right 1062450144 9:136611755-136611777 AGGGAGGAGAGAGCCAGCCAGGG No data
1062450132_1062450146 26 Left 1062450132 9:136611712-136611734 CCACTCACATTGCCACCTGCCTC No data
Right 1062450146 9:136611761-136611783 GAGAGAGCCAGCCAGGGGTGTGG No data
1062450132_1062450147 27 Left 1062450132 9:136611712-136611734 CCACTCACATTGCCACCTGCCTC No data
Right 1062450147 9:136611762-136611784 AGAGAGCCAGCCAGGGGTGTGGG No data
1062450132_1062450140 0 Left 1062450132 9:136611712-136611734 CCACTCACATTGCCACCTGCCTC No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data
1062450132_1062450143 19 Left 1062450132 9:136611712-136611734 CCACTCACATTGCCACCTGCCTC No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG 0: 1
1: 0
2: 11
3: 112
4: 873
1062450132_1062450145 21 Left 1062450132 9:136611712-136611734 CCACTCACATTGCCACCTGCCTC No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450132 Original CRISPR GAGGCAGGTGGCAATGTGAG TGG (reversed) Intergenic