ID: 1062450133

View in Genome Browser
Species Human (GRCh38)
Location 9:136611715-136611737
Sequence CTCACATTGCCACCTGCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450126_1062450133 -1 Left 1062450126 9:136611693-136611715 CCCTGCGCGTGCCCGGTCCCCAC No data
Right 1062450133 9:136611715-136611737 CTCACATTGCCACCTGCCTCCGG No data
1062450121_1062450133 25 Left 1062450121 9:136611667-136611689 CCAGCCCTGCGAGGTGTGGAGTC No data
Right 1062450133 9:136611715-136611737 CTCACATTGCCACCTGCCTCCGG No data
1062450122_1062450133 21 Left 1062450122 9:136611671-136611693 CCCTGCGAGGTGTGGAGTCAGCC No data
Right 1062450133 9:136611715-136611737 CTCACATTGCCACCTGCCTCCGG No data
1062450123_1062450133 20 Left 1062450123 9:136611672-136611694 CCTGCGAGGTGTGGAGTCAGCCC No data
Right 1062450133 9:136611715-136611737 CTCACATTGCCACCTGCCTCCGG No data
1062450127_1062450133 -2 Left 1062450127 9:136611694-136611716 CCTGCGCGTGCCCGGTCCCCACT No data
Right 1062450133 9:136611715-136611737 CTCACATTGCCACCTGCCTCCGG No data
1062450125_1062450133 0 Left 1062450125 9:136611692-136611714 CCCCTGCGCGTGCCCGGTCCCCA No data
Right 1062450133 9:136611715-136611737 CTCACATTGCCACCTGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450133 Original CRISPR CTCACATTGCCACCTGCCTC CGG Intergenic
No off target data available for this crispr