ID: 1062450134

View in Genome Browser
Species Human (GRCh38)
Location 9:136611720-136611742
Sequence ATTGCCACCTGCCTCCGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450122_1062450134 26 Left 1062450122 9:136611671-136611693 CCCTGCGAGGTGTGGAGTCAGCC No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data
1062450121_1062450134 30 Left 1062450121 9:136611667-136611689 CCAGCCCTGCGAGGTGTGGAGTC No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data
1062450127_1062450134 3 Left 1062450127 9:136611694-136611716 CCTGCGCGTGCCCGGTCCCCACT No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data
1062450129_1062450134 -8 Left 1062450129 9:136611705-136611727 CCGGTCCCCACTCACATTGCCAC No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data
1062450126_1062450134 4 Left 1062450126 9:136611693-136611715 CCCTGCGCGTGCCCGGTCCCCAC No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data
1062450125_1062450134 5 Left 1062450125 9:136611692-136611714 CCCCTGCGCGTGCCCGGTCCCCA No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data
1062450128_1062450134 -7 Left 1062450128 9:136611704-136611726 CCCGGTCCCCACTCACATTGCCA No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data
1062450123_1062450134 25 Left 1062450123 9:136611672-136611694 CCTGCGAGGTGTGGAGTCAGCCC No data
Right 1062450134 9:136611720-136611742 ATTGCCACCTGCCTCCGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450134 Original CRISPR ATTGCCACCTGCCTCCGGTG TGG Intergenic
No off target data available for this crispr