ID: 1062450136

View in Genome Browser
Species Human (GRCh38)
Location 9:136611727-136611749
Sequence TTCGCAGCCACACCGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450136_1062450147 12 Left 1062450136 9:136611727-136611749 CCTGCCTCCGGTGTGGCTGCGAA No data
Right 1062450147 9:136611762-136611784 AGAGAGCCAGCCAGGGGTGTGGG No data
1062450136_1062450145 6 Left 1062450136 9:136611727-136611749 CCTGCCTCCGGTGTGGCTGCGAA No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data
1062450136_1062450143 4 Left 1062450136 9:136611727-136611749 CCTGCCTCCGGTGTGGCTGCGAA No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG 0: 1
1: 0
2: 11
3: 112
4: 873
1062450136_1062450146 11 Left 1062450136 9:136611727-136611749 CCTGCCTCCGGTGTGGCTGCGAA No data
Right 1062450146 9:136611761-136611783 GAGAGAGCCAGCCAGGGGTGTGG No data
1062450136_1062450144 5 Left 1062450136 9:136611727-136611749 CCTGCCTCCGGTGTGGCTGCGAA No data
Right 1062450144 9:136611755-136611777 AGGGAGGAGAGAGCCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450136 Original CRISPR TTCGCAGCCACACCGGAGGC AGG (reversed) Intergenic