ID: 1062450139

View in Genome Browser
Species Human (GRCh38)
Location 9:136611734-136611756
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450139_1062450144 -2 Left 1062450139 9:136611734-136611756 CCGGTGTGGCTGCGAAGTCGGAG No data
Right 1062450144 9:136611755-136611777 AGGGAGGAGAGAGCCAGCCAGGG No data
1062450139_1062450147 5 Left 1062450139 9:136611734-136611756 CCGGTGTGGCTGCGAAGTCGGAG No data
Right 1062450147 9:136611762-136611784 AGAGAGCCAGCCAGGGGTGTGGG No data
1062450139_1062450143 -3 Left 1062450139 9:136611734-136611756 CCGGTGTGGCTGCGAAGTCGGAG No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG 0: 1
1: 0
2: 11
3: 112
4: 873
1062450139_1062450145 -1 Left 1062450139 9:136611734-136611756 CCGGTGTGGCTGCGAAGTCGGAG No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data
1062450139_1062450146 4 Left 1062450139 9:136611734-136611756 CCGGTGTGGCTGCGAAGTCGGAG No data
Right 1062450146 9:136611761-136611783 GAGAGAGCCAGCCAGGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450139 Original CRISPR CTCCGACTTCGCAGCCACAC CGG (reversed) Intergenic