ID: 1062450140

View in Genome Browser
Species Human (GRCh38)
Location 9:136611735-136611757
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450125_1062450140 20 Left 1062450125 9:136611692-136611714 CCCCTGCGCGTGCCCGGTCCCCA No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data
1062450130_1062450140 2 Left 1062450130 9:136611710-136611732 CCCCACTCACATTGCCACCTGCC No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data
1062450129_1062450140 7 Left 1062450129 9:136611705-136611727 CCGGTCCCCACTCACATTGCCAC No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data
1062450132_1062450140 0 Left 1062450132 9:136611712-136611734 CCACTCACATTGCCACCTGCCTC No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data
1062450128_1062450140 8 Left 1062450128 9:136611704-136611726 CCCGGTCCCCACTCACATTGCCA No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data
1062450127_1062450140 18 Left 1062450127 9:136611694-136611716 CCTGCGCGTGCCCGGTCCCCACT No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data
1062450131_1062450140 1 Left 1062450131 9:136611711-136611733 CCCACTCACATTGCCACCTGCCT No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data
1062450126_1062450140 19 Left 1062450126 9:136611693-136611715 CCCTGCGCGTGCCCGGTCCCCAC No data
Right 1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450140 Original CRISPR CGGTGTGGCTGCGAAGTCGG AGG Intergenic