ID: 1062450143

View in Genome Browser
Species Human (GRCh38)
Location 9:136611754-136611776
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 997
Summary {0: 1, 1: 0, 2: 11, 3: 112, 4: 873}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450128_1062450143 27 Left 1062450128 9:136611704-136611726 CCCGGTCCCCACTCACATTGCCA No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG 0: 1
1: 0
2: 11
3: 112
4: 873
1062450139_1062450143 -3 Left 1062450139 9:136611734-136611756 CCGGTGTGGCTGCGAAGTCGGAG No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG 0: 1
1: 0
2: 11
3: 112
4: 873
1062450135_1062450143 7 Left 1062450135 9:136611724-136611746 CCACCTGCCTCCGGTGTGGCTGC No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG 0: 1
1: 0
2: 11
3: 112
4: 873
1062450136_1062450143 4 Left 1062450136 9:136611727-136611749 CCTGCCTCCGGTGTGGCTGCGAA No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG 0: 1
1: 0
2: 11
3: 112
4: 873
1062450129_1062450143 26 Left 1062450129 9:136611705-136611727 CCGGTCCCCACTCACATTGCCAC No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG 0: 1
1: 0
2: 11
3: 112
4: 873
1062450130_1062450143 21 Left 1062450130 9:136611710-136611732 CCCCACTCACATTGCCACCTGCC No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG 0: 1
1: 0
2: 11
3: 112
4: 873
1062450131_1062450143 20 Left 1062450131 9:136611711-136611733 CCCACTCACATTGCCACCTGCCT No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG 0: 1
1: 0
2: 11
3: 112
4: 873
1062450137_1062450143 0 Left 1062450137 9:136611731-136611753 CCTCCGGTGTGGCTGCGAAGTCG No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG 0: 1
1: 0
2: 11
3: 112
4: 873
1062450132_1062450143 19 Left 1062450132 9:136611712-136611734 CCACTCACATTGCCACCTGCCTC No data
Right 1062450143 9:136611754-136611776 GAGGGAGGAGAGAGCCAGCCAGG 0: 1
1: 0
2: 11
3: 112
4: 873

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450143 Original CRISPR GAGGGAGGAGAGAGCCAGCC AGG Intergenic