ID: 1062450145

View in Genome Browser
Species Human (GRCh38)
Location 9:136611756-136611778
Sequence GGGAGGAGAGAGCCAGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062450131_1062450145 22 Left 1062450131 9:136611711-136611733 CCCACTCACATTGCCACCTGCCT No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data
1062450129_1062450145 28 Left 1062450129 9:136611705-136611727 CCGGTCCCCACTCACATTGCCAC No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data
1062450135_1062450145 9 Left 1062450135 9:136611724-136611746 CCACCTGCCTCCGGTGTGGCTGC No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data
1062450137_1062450145 2 Left 1062450137 9:136611731-136611753 CCTCCGGTGTGGCTGCGAAGTCG No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data
1062450139_1062450145 -1 Left 1062450139 9:136611734-136611756 CCGGTGTGGCTGCGAAGTCGGAG No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data
1062450132_1062450145 21 Left 1062450132 9:136611712-136611734 CCACTCACATTGCCACCTGCCTC No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data
1062450128_1062450145 29 Left 1062450128 9:136611704-136611726 CCCGGTCCCCACTCACATTGCCA No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data
1062450136_1062450145 6 Left 1062450136 9:136611727-136611749 CCTGCCTCCGGTGTGGCTGCGAA No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data
1062450130_1062450145 23 Left 1062450130 9:136611710-136611732 CCCCACTCACATTGCCACCTGCC No data
Right 1062450145 9:136611756-136611778 GGGAGGAGAGAGCCAGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062450145 Original CRISPR GGGAGGAGAGAGCCAGCCAG GGG Intergenic