ID: 1062451202

View in Genome Browser
Species Human (GRCh38)
Location 9:136616511-136616533
Sequence AGCCAGGCCAGCCCCTCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 1, 2: 5, 3: 24, 4: 293}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062451202_1062451210 8 Left 1062451202 9:136616511-136616533 CCGTGTGAGGGGCTGGCCTGGCT 0: 1
1: 1
2: 5
3: 24
4: 293
Right 1062451210 9:136616542-136616564 CAGGCACGTGAGGCTGCATGGGG 0: 1
1: 0
2: 1
3: 24
4: 200
1062451202_1062451213 18 Left 1062451202 9:136616511-136616533 CCGTGTGAGGGGCTGGCCTGGCT 0: 1
1: 1
2: 5
3: 24
4: 293
Right 1062451213 9:136616552-136616574 AGGCTGCATGGGGGCTGCATGGG 0: 1
1: 0
2: 1
3: 29
4: 218
1062451202_1062451205 -2 Left 1062451202 9:136616511-136616533 CCGTGTGAGGGGCTGGCCTGGCT 0: 1
1: 1
2: 5
3: 24
4: 293
Right 1062451205 9:136616532-136616554 CTCCCATCGTCAGGCACGTGAGG 0: 1
1: 0
2: 0
3: 146
4: 1409
1062451202_1062451211 9 Left 1062451202 9:136616511-136616533 CCGTGTGAGGGGCTGGCCTGGCT 0: 1
1: 1
2: 5
3: 24
4: 293
Right 1062451211 9:136616543-136616565 AGGCACGTGAGGCTGCATGGGGG 0: 1
1: 0
2: 0
3: 19
4: 182
1062451202_1062451208 6 Left 1062451202 9:136616511-136616533 CCGTGTGAGGGGCTGGCCTGGCT 0: 1
1: 1
2: 5
3: 24
4: 293
Right 1062451208 9:136616540-136616562 GTCAGGCACGTGAGGCTGCATGG 0: 1
1: 0
2: 0
3: 13
4: 160
1062451202_1062451212 17 Left 1062451202 9:136616511-136616533 CCGTGTGAGGGGCTGGCCTGGCT 0: 1
1: 1
2: 5
3: 24
4: 293
Right 1062451212 9:136616551-136616573 GAGGCTGCATGGGGGCTGCATGG 0: 1
1: 0
2: 4
3: 58
4: 463
1062451202_1062451209 7 Left 1062451202 9:136616511-136616533 CCGTGTGAGGGGCTGGCCTGGCT 0: 1
1: 1
2: 5
3: 24
4: 293
Right 1062451209 9:136616541-136616563 TCAGGCACGTGAGGCTGCATGGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062451202 Original CRISPR AGCCAGGCCAGCCCCTCACA CGG (reversed) Intergenic
900116119 1:1028612-1028634 AGCCACGCCACCCTCTCCCAAGG + Intronic
900116140 1:1028673-1028695 AGCCACGCCACCCTCTCCCAAGG + Intronic
900116244 1:1028978-1029000 AGCCACGCCACCCTCTCCCAAGG + Intronic
900414290 1:2527995-2528017 AGGCAGGGCAGGCCCACACACGG + Intergenic
901211134 1:7526678-7526700 GGCGAGGCCAGCCACTCACTTGG + Intronic
901497200 1:9629007-9629029 ACCCAGGCCCGCCCCTCACTTGG - Intergenic
901655713 1:10768079-10768101 AGCCAGGCCAGCCTCTACCATGG + Intronic
901780350 1:11590183-11590205 AGCAAGGGCACCCCCTGACATGG + Intergenic
902290600 1:15432384-15432406 AGCCCTGCCAGCCCCTCAGCTGG + Intergenic
903179381 1:21597699-21597721 AGCCGGGCCACCCCCTCTGAAGG - Exonic
903659724 1:24969731-24969753 AGCCAGATCAGCCCCTCTCCGGG + Intergenic
904465359 1:30704455-30704477 ACCCAGGCCAGCCCAGGACAGGG + Intergenic
904869211 1:33606086-33606108 AGTCAGGCCACCCACTCTCATGG - Intronic
905624813 1:39482183-39482205 AGCCAGGCCATCTCCTGACTTGG + Intronic
905629281 1:39509995-39510017 TGGCAGGCCAGCCCCTGCCACGG + Intronic
905668477 1:39776198-39776220 TGGCAGGCCAGCCCCTGCCACGG - Intronic
906562234 1:46767651-46767673 ATCCAGGCCAGCCTCTGCCATGG - Intronic
907324541 1:53628411-53628433 AGCCAGTACAGTCCCTCCCATGG - Intronic
907453105 1:54559884-54559906 AGCCAGGTCAGCCCAGGACAAGG - Intronic
907951236 1:59186158-59186180 TGCCAGGCCAGCACCCAACATGG + Intergenic
908123628 1:61008571-61008593 ATCCAGGGCTGCCACTCACATGG - Intronic
909663762 1:78111368-78111390 TGTAAGCCCAGCCCCTCACAGGG - Intronic
909949638 1:81704400-81704422 ATCCAGGCCCGCCGCTCCCAGGG - Intronic
912184167 1:107254531-107254553 AGCGAGGCAAGCGCCTCAAAGGG - Intronic
912300302 1:108509179-108509201 AGCCAGGCGAGCCCATCTCATGG - Intergenic
912547066 1:110458408-110458430 AGCCAGGCCAGGCCCCCACAGGG + Intergenic
914508588 1:148310264-148310286 AGCCAGGCGAATCCCGCACATGG - Intergenic
914714117 1:150239991-150240013 AGCCAGGCAATCCCCTAAAAGGG - Intergenic
915567098 1:156721196-156721218 AGCCAGACCAGACCCAGACATGG - Intergenic
915605421 1:156947339-156947361 AGCCGGGCCAGCTCCTCCCGGGG + Exonic
916108395 1:161446998-161447020 AGCGAGGCGAGCACCTGACAAGG + Intergenic
916109982 1:161454378-161454400 AGCGAGGCGAGCACCTGACAAGG + Intergenic
916111568 1:161461789-161461811 AGCGAGGCGAGCACCTGACAAGG + Intergenic
916113154 1:161469169-161469191 AGCGAGGCGAGCACCTGACAAGG + Intergenic
921155002 1:212432776-212432798 AGCCCGGCCAGCCCCACCCCGGG + Intergenic
922621038 1:226988359-226988381 ACCCAGGCCAGCCCCAGCCAGGG + Intergenic
923403614 1:233639043-233639065 AGCCAGGACAAACCCACACATGG - Intronic
924704801 1:246491779-246491801 AAGCTGGCCAGGCCCTCACAGGG + Intronic
1062774567 10:135090-135112 AGCCGCGGCAGCCGCTCACATGG - Intronic
1063930659 10:11025491-11025513 AGCCAGGCACCTCCCTCACAAGG - Intronic
1064418387 10:15169097-15169119 ACCCTGGCCAGCCCTGCACAGGG + Intergenic
1065528170 10:26643300-26643322 ACCAAGGCCAGCCCCACTCAGGG + Intergenic
1066445691 10:35480604-35480626 AGGCAGTCCAGCCACTCAGAGGG + Intronic
1066656921 10:37705078-37705100 AGCCAGCCAAGCCCTACACAAGG - Intergenic
1067101950 10:43340285-43340307 CCCCAGGCCAGCCTCTCCCATGG - Intergenic
1068117735 10:52752582-52752604 CACAAGGCCAGGCCCTCACAGGG - Intergenic
1069082381 10:64102134-64102156 ATCCAGGCCACCACCTGACAAGG - Intergenic
1069788386 10:71004283-71004305 AGCCAGACCTGCCCCTTTCATGG + Intergenic
1069820702 10:71225903-71225925 CACCTTGCCAGCCCCTCACACGG + Intronic
1070744058 10:78922147-78922169 AGGCAGGCCAGCCCCTCTCTAGG + Intergenic
1070805290 10:79267161-79267183 AGACACCCCAGGCCCTCACAGGG - Intronic
1072721136 10:97781693-97781715 AGCCAAGCCAGCCGGCCACAGGG - Intergenic
1073441171 10:103553676-103553698 ACCCAGTCCAGTCCCTTACAGGG + Intronic
1074698796 10:116075079-116075101 AGTAAGGCCAGCCCATCAGAAGG - Intronic
1075647089 10:124103786-124103808 AGCCAGGCCAGGCTCTATCACGG + Intergenic
1075653200 10:124143556-124143578 AGGCAGCCCAGGGCCTCACATGG + Intergenic
1076714057 10:132354437-132354459 AGCGGGGCCAGCACCACACATGG + Intronic
1077364268 11:2155213-2155235 AGCCAGCCCAGCCCTTGCCAGGG - Intronic
1077443029 11:2577552-2577574 GGCCAGGCCTCCCCGTCACATGG - Intronic
1077462166 11:2715999-2716021 AGGCAGGGCAGCCTCTCCCAGGG - Intronic
1077888644 11:6403672-6403694 GGCCGGGCCTCCCCCTCACAGGG - Exonic
1078444622 11:11394920-11394942 GGCCAGCCCAGCCTCTCACCTGG - Intronic
1080595740 11:33773555-33773577 AGCCATGCCACCCCCTGTCAAGG + Intronic
1083159804 11:60848050-60848072 AGCCTGGCTGGCCCCTCACCTGG - Exonic
1083253073 11:61481028-61481050 GGCCAGGTCAGCCCCTCAGTGGG + Intronic
1083898578 11:65632707-65632729 TGCCAGGCCAGCTCCTCTCCCGG + Intronic
1083933854 11:65860355-65860377 AGCCAGTCCTCCCCGTCACAGGG + Intronic
1084151862 11:67291378-67291400 AGCCAGCCCAGCCCTTCATCAGG - Intronic
1084315498 11:68343128-68343150 TGCCAGGCCTGCACCTCACCAGG - Intronic
1084531518 11:69730577-69730599 AGCCAGGCCAGCCCCTCCCTGGG - Intergenic
1084779694 11:71400106-71400128 AGGCAGGTGAGCCCCCCACAAGG + Intergenic
1086758350 11:90594057-90594079 AGCCAAGACAGCCCCTCTCTAGG + Intergenic
1089059980 11:115618547-115618569 AGCCAGTTCACCACCTCACAGGG - Intergenic
1090239807 11:125174087-125174109 AGGCAGGACAGCTCCTCAGAAGG - Intronic
1090808145 11:130215669-130215691 AGCCAGGCTAGCCCCTCTGCAGG - Intergenic
1092063047 12:5566147-5566169 AGCAAGGCCAGCCCCTCTAGTGG - Intronic
1092140596 12:6180710-6180732 AGCCAGGCCTGCCCCGCAGTGGG - Intergenic
1093055008 12:14547300-14547322 AGCCAGTCCTGCCACACACAGGG + Intronic
1095088955 12:38086543-38086565 AGGCAGGGCCTCCCCTCACAGGG + Intergenic
1103274890 12:119703293-119703315 AGCCAGTTCAGTCCCTTACAGGG + Intronic
1103724604 12:122991418-122991440 AGCCGGGCCCACCCCTCACCTGG - Intronic
1104014058 12:124950592-124950614 AGGCATGGCAGCCCCTCCCACGG - Intronic
1104950485 12:132437687-132437709 GGCCAGGCCTGCCCAACACAGGG + Intergenic
1105497087 13:20939688-20939710 AGCCTGGGCAGCTCCTCAAAGGG - Intergenic
1108076244 13:46682470-46682492 ACTCAAGCCAGCCCGTCACAAGG + Intronic
1108355237 13:49624072-49624094 AGCCATGCCAGACCCTCCCTGGG - Intergenic
1113876743 13:113599500-113599522 AGCCAGGGCAGCCCATCAACAGG - Intronic
1114212784 14:20630048-20630070 AGAAAGGCCTGCCCCTCAAAAGG - Intergenic
1115460270 14:33652497-33652519 CACTAGGCCAGCCCATCACAAGG - Intronic
1116520338 14:45839216-45839238 AGCCAGGCCTGTCCATCACCAGG + Intergenic
1118616760 14:67579308-67579330 AGCACGCCCAGCTCCTCACATGG - Exonic
1118981971 14:70724465-70724487 AGCCCTGCCTGCCCCTCACCTGG - Intronic
1119431608 14:74571660-74571682 AGCCAGGCCACGCCCTTCCAGGG - Intronic
1119657157 14:76425448-76425470 AGGCAGGCCAGGACCTCAAAGGG - Intronic
1119736877 14:76988260-76988282 AGCCAGGCCAGCCCCTAAACTGG + Intergenic
1121382943 14:93490071-93490093 GGGCATGCCACCCCCTCACAAGG - Intronic
1121675282 14:95747398-95747420 ACCCAGGCCTGCCCCTTCCATGG + Intergenic
1122153461 14:99736979-99737001 AGCCAATCCAGCCCCTCCCCTGG - Intergenic
1122204971 14:100143731-100143753 AGCGAGGCCGGCCCCTTACGTGG - Exonic
1122272663 14:100575332-100575354 AGCGATGCCAGCCCTTCACAGGG - Intronic
1122498879 14:102180792-102180814 ATGCAGGCCAGCCCCTCACATGG - Intronic
1123012453 14:105356034-105356056 AGCCAGCGCAGCCCCTCATTGGG + Intronic
1123113358 14:105883031-105883053 GACCAGGCCAGCCCCTAGCAGGG + Intergenic
1123402693 15:20003459-20003481 GACCAGGCCAGCCCCTAGCAGGG + Intergenic
1123469912 15:20541951-20541973 AGCCAGCCCCGCCCCTCTCCTGG - Intergenic
1123512032 15:21010113-21010135 GACCAGGCCAGCCCCTAGCAGGG + Intergenic
1123648143 15:22458730-22458752 AGCCAGCCCCGCCCCTCTCCTGG + Intergenic
1123730206 15:23136973-23136995 AGCCAGCCCCGCCCCTCTCCTGG - Intergenic
1123748344 15:23334383-23334405 AGCCAGCCCCGCCCCTCTCCTGG - Intergenic
1123763113 15:23447430-23447452 AGCCAGCCCCGCCCCTCTCCTGG - Intergenic
1123995889 15:25717843-25717865 AGCAAAGCCAACCCCTCCCAAGG - Intronic
1124280722 15:28358270-28358292 AGCCAGCCCCGCCCCTCTCCTGG - Intergenic
1124301982 15:28553359-28553381 AGCCAGCCCCGCCCCTCTCCTGG + Intergenic
1128061022 15:64736179-64736201 AGTCAGTCCAGCACCCCACAGGG - Intergenic
1129454530 15:75669699-75669721 AGCCGGGCTAACCACTCACAGGG - Intergenic
1129698236 15:77752773-77752795 ACAGAGGCCAGCCCCTCATAGGG + Intronic
1129854128 15:78811812-78811834 AAGCAGGGCAGCCCCTCAAAAGG + Intronic
1129893768 15:79089411-79089433 AGCCAGGCCTGGCTCTAACAGGG - Intronic
1131158908 15:90091709-90091731 AGCCAGGCCCGCCCTTCACCAGG + Intronic
1131301466 15:91203220-91203242 AGCCAGGCCAGGCCCCTACCTGG - Intronic
1132373109 15:101311454-101311476 AGCAAGGGCAGCACATCACATGG - Intronic
1132721983 16:1321004-1321026 AGCCACAGCAGCACCTCACAGGG - Intronic
1134108652 16:11501087-11501109 ACCCGGGTCAGCCCCTCCCAAGG - Intronic
1134444361 16:14319717-14319739 AGCCAGGCCTGCCCCTCTCAGGG - Intergenic
1134597069 16:15504202-15504224 AGCCAGGCCAGCCCTTGAAGAGG - Intronic
1135939731 16:26810597-26810619 ACCCAACCCAGCCCCTCAGAGGG + Intergenic
1136145082 16:28311844-28311866 ATCCAGCCCAGCCCTTCCCAGGG + Intronic
1136535614 16:30897257-30897279 AGCCAGGCCAGCGCCTTGCATGG + Intronic
1137056832 16:35750035-35750057 TGCCAGGGCAGGCCCCCACAGGG - Intergenic
1137636162 16:49988322-49988344 AGGAAGGCCAGCACGTCACACGG - Intergenic
1137716840 16:50603351-50603373 AGCCTGGCCAGGCGCTCTCAAGG - Intronic
1137782591 16:51110317-51110339 ATCCAGGAGAGCCCTTCACAAGG + Intergenic
1139415183 16:66801980-66802002 AGCCAGGCCTCCACCTCACCAGG + Intergenic
1139422357 16:66856536-66856558 ACCCTGTCCAGCCCCTCCCAGGG + Intronic
1139884271 16:70197563-70197585 AGCCAGCCCAGCCTCTGCCAAGG + Intergenic
1140368245 16:74397933-74397955 AGCCAGCCCAGCCTCTGCCAAGG - Intergenic
1141525330 16:84607331-84607353 AGGCAGGCCAGCGCGGCACAGGG + Intronic
1141780419 16:86156378-86156400 AGCCTGGCCAGACCTTCACCAGG - Intergenic
1142182759 16:88679216-88679238 GGCCAGGCCAGCCTCCCGCAGGG + Intronic
1142589003 17:992968-992990 AGTAAGCCCAGCCCCTCACCAGG + Intergenic
1142598942 17:1043776-1043798 TGCCAGGGCAGCCCCTCCCTGGG - Intronic
1143116168 17:4582932-4582954 AGCCTGTCCAGTCCCTCTCAAGG + Intergenic
1143952990 17:10648219-10648241 GGCCAGGGCAGTCCCTGACATGG - Intronic
1144587324 17:16495092-16495114 GGCCAGACCAGCCCCTCACTTGG + Intergenic
1145314159 17:21719175-21719197 ATCCAGCCCAGCCCATCAAAAGG - Intergenic
1145898635 17:28475365-28475387 GGAGAGGCCAGCCCCTCTCAAGG + Intronic
1146568432 17:33933126-33933148 AGCCAGCCATGCCCATCACAGGG + Intronic
1147449214 17:40493507-40493529 AGCCAGGTCAGCTCCCCACTGGG - Intronic
1147557668 17:41489669-41489691 AGCCAGGCAAGCAGCTCCCAAGG + Exonic
1147654702 17:42082234-42082256 ACCAAGCCCAGCACCTCACAGGG + Intergenic
1147906961 17:43829817-43829839 AGGCTGGCCCGCCGCTCACAGGG + Intronic
1148105323 17:45115571-45115593 CCCCTAGCCAGCCCCTCACAAGG - Intronic
1150130307 17:62665649-62665671 CAAGAGGCCAGCCCCTCACATGG - Intronic
1151956234 17:77381483-77381505 GGCCTGGCCTGCCCCTCGCAGGG - Intronic
1152203156 17:78958811-78958833 GGCCAGGTCAGCCCATCCCAAGG - Intergenic
1152566580 17:81103095-81103117 AGCCAGGCCTGACCCCCACTGGG + Intronic
1152585698 17:81188550-81188572 AGCCTGGCCAGCCCCTCCTGGGG + Intergenic
1155742320 18:29303909-29303931 GTCCATGCCAGCCCCTCTCAGGG - Intergenic
1157282262 18:46353853-46353875 AGCCAGGCCACCCCACCACAAGG - Intronic
1157397604 18:47355815-47355837 AGCCAGTCCATCACCTCCCATGG - Intergenic
1160420094 18:78738128-78738150 GGCCAGGGCAGCACCTCACTGGG - Intergenic
1160663849 19:313717-313739 AGCCAACTCAGCCCCTGACAGGG + Intronic
1161323202 19:3650641-3650663 AGGCAGGCCCTGCCCTCACAGGG - Intronic
1161614762 19:5263906-5263928 AGGCAGGCCAGGCCGGCACAGGG + Intronic
1163128930 19:15259936-15259958 ACCGAGGCAAGCCTCTCACAAGG + Intronic
1164207630 19:23071233-23071255 AGCCGGGGCAGCCCCACACTCGG + Intergenic
1164438638 19:28254294-28254316 AGCCAGGACTGACACTCACAGGG - Intergenic
1164902955 19:31943590-31943612 ATCCAGGCCAGCCCGGCAGAGGG + Intergenic
1165793581 19:38506231-38506253 GCCCAGGCCAGCCCCTCCCCAGG - Intronic
1165811968 19:38617305-38617327 ACCCAGCCCAGCCCCTAACCCGG - Intronic
1166662636 19:44657351-44657373 AGCCAGGCTAGGCCCCCAGAGGG + Intronic
1166895924 19:46021930-46021952 AGCCAAGGCAGCCACTCTCAGGG + Intronic
1167488261 19:49776100-49776122 AGCACGGCCTGCCCCTCCCATGG + Intronic
925244392 2:2367427-2367449 AGCCAGGCCCGCCCCACAGATGG - Intergenic
925346191 2:3173661-3173683 AGTCAGTCCAGACCCTCCCAAGG - Intergenic
925983237 2:9193750-9193772 ACTCAGGCCAGCACCTCAAATGG + Intergenic
926132934 2:10316498-10316520 AGTCAGGCATGGCCCTCACAAGG - Intronic
926224929 2:10960908-10960930 AGCCACGCCGGCCCCTCCCCGGG - Intergenic
928007660 2:27578159-27578181 ACCAAGGCCAACCCCTCAAATGG + Exonic
928024732 2:27730273-27730295 GGCTAGCTCAGCCCCTCACAGGG - Intergenic
928370588 2:30737377-30737399 TGCCCTGCCAGCCCCTCACTCGG - Intronic
928377617 2:30788443-30788465 ATCCAGGCCAGCCTCACAGATGG - Intronic
930022078 2:47007666-47007688 AGGCAGGCCAGGCCCTGGCAGGG + Intronic
933727927 2:85436969-85436991 AGGTAGGCCAGTCCCTCTCAGGG - Exonic
934573390 2:95385545-95385567 AGCCAGCCCAGCTCCACTCAGGG + Exonic
935414810 2:102804065-102804087 ACCTTGGCCAGCCCCTCCCAGGG - Intronic
937276161 2:120685509-120685531 AGCAAAGCCAGCCTCTCCCATGG + Intergenic
938118224 2:128616529-128616551 AAGCAAGCCAGCCCCTCGCATGG - Intergenic
938378830 2:130825436-130825458 AGCCAGGCCTGCCCCTGAGATGG + Intergenic
943749842 2:191500070-191500092 AGCCAGCCCTGCCTCTGACAGGG - Intergenic
948376700 2:237525624-237525646 AGAGAAGGCAGCCCCTCACAAGG + Exonic
948463867 2:238143051-238143073 ACCCAGGCACGCCCCTCACAGGG - Intronic
1169216979 20:3799805-3799827 AGCCAGGCCAGCTCCTCACAGGG + Intronic
1171142618 20:22755973-22755995 ACAAAGGCCAGCCCCTCGCAAGG - Intergenic
1172618958 20:36307155-36307177 GGTCAGCCCAGCCCCTCCCAGGG - Intronic
1175133820 20:56808496-56808518 AGCCAAGCCATCCCCACCCATGG + Intergenic
1176062181 20:63177282-63177304 ACACACTCCAGCCCCTCACATGG - Intergenic
1176123405 20:63464374-63464396 ACCCACCCCAGCCCCTCACCTGG + Intronic
1176299228 21:5090765-5090787 AGCCAGGACACCCCCTCCCGGGG - Intergenic
1176411434 21:6451409-6451431 AGCCAGGCCTGGCCCTCCAAGGG + Intergenic
1178323654 21:31625478-31625500 AGCCAGGACAGCCCGTCAATAGG + Intergenic
1178374930 21:32058951-32058973 AGCCAGGACAGCACATGACATGG + Intergenic
1179370578 21:40802716-40802738 AGGCAGCCCAGGCCATCACATGG - Intronic
1179686927 21:43059731-43059753 AGCCAGGCCTGGCCCTCCAAGGG + Intronic
1179857798 21:44171182-44171204 AGCCAGGACACCCCCTCCCGGGG + Intergenic
1180019898 21:45116247-45116269 ACCCAGGCCAGCCCCACCCTGGG - Intronic
1180722195 22:17917717-17917739 GGCCAGGGCAGCCCCGCCCAGGG - Intronic
1180941990 22:19665717-19665739 AGCCAGCCCAGCTTCTCCCAGGG - Intergenic
1181035683 22:20168761-20168783 AGCCAGGCCAACCCCACGCAGGG - Intergenic
1181404600 22:22673732-22673754 ACCCAGGCCAGCCCTGCTCATGG - Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183622309 22:38981800-38981822 GGGCAGGTCAGCCCCTCAGAGGG - Intronic
1184276768 22:43413096-43413118 AGCCAGGCCAGCCCAGCACTGGG - Intronic
1184432361 22:44448993-44449015 AGTCAGGCCAGAGCCTCGCAGGG + Intergenic
951558798 3:23945819-23945841 GGCCCGGCCCCCCCCTCACATGG + Intronic
953682643 3:45051443-45051465 AGCCACGCTACCCCGTCACACGG + Intergenic
953882793 3:46700358-46700380 GTCCAGGCCAGAACCTCACAGGG + Intergenic
954647531 3:52140663-52140685 TGCCAGGCCAGCCCCTCTTCTGG - Intronic
959402682 3:105922187-105922209 AGTCAGCCCAGCACCACACATGG - Intergenic
961447248 3:126986640-126986662 AGCCAGGCCCTGCTCTCACAGGG + Intergenic
961713268 3:128843013-128843035 AGCCAGGCCTGCTTCCCACAGGG + Intergenic
962375941 3:134858809-134858831 AGCCAGGACAGCCCCACAGTGGG + Intronic
962414417 3:135169070-135169092 AGCTATGCCAGGCCATCACATGG + Intronic
963233499 3:142933485-142933507 TGCCAAGCCAGTCCTTCACAAGG + Intergenic
964210469 3:154221063-154221085 AGCAAGGCCAGGCTCTCAGAAGG - Intronic
966298744 3:178454944-178454966 AGCCAGGCCAGCACTCCACTGGG + Intronic
967730045 3:192899096-192899118 TGCAAGGCCAGTACCTCACATGG + Intronic
968087347 3:195879773-195879795 AGCGAGCCCTGCCCCTCAAAGGG + Intronic
968575646 4:1364832-1364854 AGCCCTGCCAGCCCCTCTCCTGG + Intronic
968599069 4:1500655-1500677 AGTCAGGCCAGGCCCTCTCCTGG - Intergenic
968895996 4:3403755-3403777 CCGCAAGCCAGCCCCTCACAGGG + Intronic
969167498 4:5329599-5329621 TGTCAGCCCAGCCCCTCCCAGGG + Intronic
969673865 4:8604197-8604219 GGCCAGGCCAGGCTCTCCCAAGG - Intronic
969710229 4:8839095-8839117 AGCCAGGCCTGCTCCTCATGCGG + Intergenic
973867203 4:55125684-55125706 GGCCAGCCCCGCCCCTCACCCGG + Intergenic
982574810 4:157096199-157096221 AGCCAGGCCTTCCCCAGACAGGG - Intronic
985553362 5:544202-544224 AGTGAGACCAGCCCCTCCCACGG - Intergenic
985920337 5:2966557-2966579 ATCCAGCCCAGCCCCACCCAGGG + Intergenic
985948214 5:3202802-3202824 GACCAGGCCAGCTCCTGACATGG - Intergenic
986104456 5:4646296-4646318 AGCCAGGTCTGCCCCACAGACGG + Intergenic
986741884 5:10711935-10711957 AGCCAGAACAGCCTCTCACTTGG - Intronic
988870607 5:35385133-35385155 AGCCAGCCCTGCCCCTACCAAGG + Intergenic
990304625 5:54482205-54482227 AGCCAAGGCAGCCCCCCAGAAGG + Intergenic
991450012 5:66741735-66741757 AGCCAGGCCACCTCCTCACCAGG - Intronic
997195410 5:131975726-131975748 AGCCAGGGGAGCCCTGCACAAGG + Intronic
997382068 5:133445271-133445293 AGCCAGGCCAGTCCCTCACCTGG - Intronic
997391313 5:133519413-133519435 GGCCAGCTCAGCACCTCACAAGG - Intronic
998167111 5:139850513-139850535 AGCCAGGCCTGCCCAGCACAGGG + Intronic
998204591 5:140149612-140149634 AGCAGGGCCAGCTCCTCACCAGG + Intergenic
998388530 5:141772413-141772435 AGCCAGGGCTGCACCCCACATGG - Intergenic
1000293641 5:159894019-159894041 ACTCAGGCTGGCCCCTCACATGG + Intergenic
1001683752 5:173577371-173577393 AGCATGGGCAGGCCCTCACAGGG - Intergenic
1002199738 5:177521014-177521036 TGCCAGGCCAGCTCCTCTCTGGG - Intronic
1006376954 6:33676966-33676988 AGCCAGGCCCAGCCCTCACAGGG - Intronic
1007173839 6:39883120-39883142 AGCCAGCCAAGCTCCTGACAGGG - Intronic
1007605695 6:43116294-43116316 AGCCTGGCCATCCCTTCTCACGG - Intronic
1007790906 6:44307554-44307576 AGCCAGGCCCTGCCCTCACGGGG + Exonic
1010160901 6:72853635-72853657 AGCCAGGGCTGCCCCACAGAAGG - Intronic
1013054669 6:106572230-106572252 ACCCAGGTCAGGCTCTCACAAGG + Intronic
1015471638 6:133612810-133612832 AGCCCTGCAAGCCCCTAACATGG + Intergenic
1016908231 6:149172291-149172313 TCCCAGGCCTGACCCTCACAAGG + Intergenic
1018779208 6:167046737-167046759 ACCAAGGCCAGGCCCTCTCAGGG + Exonic
1018901155 6:168052413-168052435 AGCCTGGCCCGCACCCCACAGGG + Intergenic
1019140402 6:169938878-169938900 AGCAAGGCCAGATGCTCACATGG + Intergenic
1019478436 7:1255177-1255199 GGCCAGGCCAGCCCCGCCCCAGG - Intergenic
1019605335 7:1907248-1907270 ACCCAGGCCAGCTCCTCACTGGG - Intronic
1019633745 7:2064451-2064473 AGCCATCCCAGCCTCTTACAGGG - Intronic
1019730497 7:2627077-2627099 AGCCAGGCCAGGAGCTCCCAGGG - Intergenic
1021582067 7:22166608-22166630 AGACAGGCCATTCCCCCACATGG - Intronic
1023848242 7:44135432-44135454 ACCCAGGCCAGGACCACACAGGG + Intergenic
1024558368 7:50623029-50623051 AGCCAGGGCAGCTTCACACATGG - Intronic
1025887304 7:65609303-65609325 AGCCAGGGCATTCCCTCACAGGG - Intergenic
1026023389 7:66727679-66727701 CTCCAGGCCAGCCCCTCGCAGGG + Intronic
1029035232 7:97513054-97513076 AGCAGGACCAGCCCCTGACAAGG + Intergenic
1029581479 7:101439343-101439365 AGAAAGACCAGCCCCTCAGAGGG + Intronic
1029658133 7:101940942-101940964 AGCGAGGCCAGCCCCTTCCCTGG + Intronic
1029697682 7:102224964-102224986 TGCCAGGCCGGCCCCTCGCATGG + Intronic
1029724386 7:102392702-102392724 AGCCAGGCCAAGCCCTCCCCAGG + Intronic
1030384784 7:108855453-108855475 AACCAGCACAGCCCCTCACTCGG + Intergenic
1031855107 7:126912628-126912650 AGCCAGGGCATTCCCTCACAGGG + Intronic
1032079653 7:128852530-128852552 AGGCAGGCCCTGCCCTCACAGGG - Intronic
1034263499 7:149771300-149771322 AGCCGCGCCACCCCCTCACCTGG + Intronic
1034270285 7:149800343-149800365 ACGCAGCCCAGCACCTCACAGGG - Intergenic
1035593120 8:833391-833413 AGCCAGGCCAGCTCCTCTTGAGG + Intergenic
1035717361 8:1764132-1764154 AGCCACCCCGGCCCCTCACCCGG - Intronic
1037678286 8:21071339-21071361 AGACAAGACAGCCCTTCACATGG + Intergenic
1037951863 8:23023879-23023901 GGACAGGCCAGCCCCTCAGGAGG + Intronic
1041225034 8:55689571-55689593 ACCCAGGCCAGCACCACTCAGGG + Intergenic
1043420630 8:80094909-80094931 AACCAGGCCTGCCTCTCCCAGGG - Intronic
1045352356 8:101353319-101353341 TGACAGGCCAGGCCCACACATGG - Intergenic
1046286017 8:112093115-112093137 AGGCAGGACAGCCACTCACCTGG - Intergenic
1049054589 8:140225840-140225862 AGCCTGGCCAGCTCCTCCCGAGG + Intronic
1049353906 8:142178395-142178417 AGCCAGTGCATCCCCTCACCTGG + Intergenic
1049583727 8:143423675-143423697 AGCCTGGCCCCACCCTCACAGGG - Intronic
1049604083 8:143521073-143521095 GGCCGGGCCTGCCCCTCCCAGGG - Intronic
1049640409 8:143712640-143712662 ACCCAGGCCAGATCCACACAAGG + Intronic
1050077075 9:1876393-1876415 ATTCTGCCCAGCCCCTCACACGG + Intergenic
1055414738 9:76069277-76069299 GGCCAGGTCAGCCCTTCTCATGG + Intronic
1055650306 9:78400391-78400413 AGCCTGGCAAGCCCCTAAGAGGG - Intergenic
1056390014 9:86132213-86132235 AGCCATGCCAGTCCATAACAAGG + Intergenic
1056775024 9:89505597-89505619 GTGCAGGCCAGCCCCTCAAAAGG + Intergenic
1057216996 9:93234643-93234665 GGCCAGCCCTGCCCCTCACTTGG - Intronic
1058022014 9:100099274-100099296 AGCTAGCCGAGCCCCTCAAAAGG - Exonic
1060726771 9:126011361-126011383 AGAAAGGCCAGCACCCCACAGGG + Intergenic
1060756861 9:126219940-126219962 AGCCAGGTCACGCCCCCACAGGG + Intergenic
1060893087 9:127200807-127200829 AGGCAGGCCAGCACCTCCCCTGG + Intronic
1060958654 9:127663399-127663421 GTCCAGGCCAGCTCCTCACTTGG - Intronic
1061060122 9:128246079-128246101 AGCCAGGCCAGCCTCAGGCAGGG - Intronic
1061271582 9:129546767-129546789 TGCCAGGCCAGCCCTACACTAGG - Intergenic
1061500977 9:131001699-131001721 AGGCATGCCAGCCCCGCAGAGGG - Intergenic
1061667809 9:132170495-132170517 AGGCATCTCAGCCCCTCACAGGG + Intronic
1062358238 9:136175194-136175216 AGCCAGGCCTGCCCAGCCCACGG - Intergenic
1062451202 9:136616511-136616533 AGCCAGGCCAGCCCCTCACACGG - Intergenic
1062457646 9:136646991-136647013 GGCCAGGCCAGCGCCTCTCTGGG - Intergenic
1186428646 X:9485586-9485608 AGCCCGGCCATCCCATCAGAAGG - Intronic
1192220940 X:69196892-69196914 AGCCTGGCCAGCCCCCTGCACGG - Intergenic
1194305740 X:92245923-92245945 AACATGGCCAGCCCCTAACATGG - Intronic
1195106640 X:101609349-101609371 AGCCTGGGCAGCTCCACACATGG + Intergenic
1196276259 X:113768784-113768806 AGAAAGGCCAGCCCCTAAAATGG - Intergenic
1197603732 X:128560612-128560634 ACCAAGGCAAGCCCCTCGCAGGG + Intergenic
1197837567 X:130711855-130711877 AGCCAGGCCAGCCCTCCAGATGG + Intronic
1202232758 Y:22672361-22672383 AGCCAGGCCAGGGGCACACAGGG - Intergenic
1202310398 Y:23523797-23523819 AGCCAGGCCAGGGGCACACAGGG + Intergenic
1202560404 Y:26146797-26146819 AGCCAGGCCAGGGGCACACAGGG - Intergenic