ID: 1062451939

View in Genome Browser
Species Human (GRCh38)
Location 9:136619431-136619453
Sequence AGAGAAAATGAGATCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062451939_1062451945 10 Left 1062451939 9:136619431-136619453 CCTCTCTGGATCTCATTTTCTCT No data
Right 1062451945 9:136619464-136619486 GAAGAGGCCAGTCCTGCCACGGG No data
1062451939_1062451952 22 Left 1062451939 9:136619431-136619453 CCTCTCTGGATCTCATTTTCTCT No data
Right 1062451952 9:136619476-136619498 CCTGCCACGGGAGGAAGAGGGGG No data
1062451939_1062451944 9 Left 1062451939 9:136619431-136619453 CCTCTCTGGATCTCATTTTCTCT No data
Right 1062451944 9:136619463-136619485 AGAAGAGGCCAGTCCTGCCACGG No data
1062451939_1062451946 13 Left 1062451939 9:136619431-136619453 CCTCTCTGGATCTCATTTTCTCT No data
Right 1062451946 9:136619467-136619489 GAGGCCAGTCCTGCCACGGGAGG No data
1062451939_1062451950 21 Left 1062451939 9:136619431-136619453 CCTCTCTGGATCTCATTTTCTCT No data
Right 1062451950 9:136619475-136619497 TCCTGCCACGGGAGGAAGAGGGG No data
1062451939_1062451953 25 Left 1062451939 9:136619431-136619453 CCTCTCTGGATCTCATTTTCTCT No data
Right 1062451953 9:136619479-136619501 GCCACGGGAGGAAGAGGGGGAGG No data
1062451939_1062451948 19 Left 1062451939 9:136619431-136619453 CCTCTCTGGATCTCATTTTCTCT No data
Right 1062451948 9:136619473-136619495 AGTCCTGCCACGGGAGGAAGAGG No data
1062451939_1062451949 20 Left 1062451939 9:136619431-136619453 CCTCTCTGGATCTCATTTTCTCT No data
Right 1062451949 9:136619474-136619496 GTCCTGCCACGGGAGGAAGAGGG No data
1062451939_1062451943 -6 Left 1062451939 9:136619431-136619453 CCTCTCTGGATCTCATTTTCTCT No data
Right 1062451943 9:136619448-136619470 TTCTCTGAGGTAGGGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062451939 Original CRISPR AGAGAAAATGAGATCCAGAG AGG (reversed) Intergenic