ID: 1062454200

View in Genome Browser
Species Human (GRCh38)
Location 9:136628027-136628049
Sequence GGGCTGCGGCGCCACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062454183_1062454200 29 Left 1062454183 9:136627975-136627997 CCAAGGCGGTGATAACACAGTGG No data
Right 1062454200 9:136628027-136628049 GGGCTGCGGCGCCACATGGATGG No data
1062454191_1062454200 6 Left 1062454191 9:136627998-136628020 CCATCTCGGGGGTGGGCCAGCTC No data
Right 1062454200 9:136628027-136628049 GGGCTGCGGCGCCACATGGATGG No data
1062454197_1062454200 -10 Left 1062454197 9:136628014-136628036 CCAGCTCGGGCCAGGGCTGCGGC No data
Right 1062454200 9:136628027-136628049 GGGCTGCGGCGCCACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062454200 Original CRISPR GGGCTGCGGCGCCACATGGA TGG Intergenic
No off target data available for this crispr