ID: 1062454940

View in Genome Browser
Species Human (GRCh38)
Location 9:136631639-136631661
Sequence CATCCATGGTGGCCCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062454940_1062454947 -10 Left 1062454940 9:136631639-136631661 CCCCAGGAGGGCCACCATGGATG No data
Right 1062454947 9:136631652-136631674 ACCATGGATGTCTGGGGCCGAGG No data
1062454940_1062454951 8 Left 1062454940 9:136631639-136631661 CCCCAGGAGGGCCACCATGGATG No data
Right 1062454951 9:136631670-136631692 CGAGGAGGCACACAGCCACCCGG No data
1062454940_1062454953 10 Left 1062454940 9:136631639-136631661 CCCCAGGAGGGCCACCATGGATG No data
Right 1062454953 9:136631672-136631694 AGGAGGCACACAGCCACCCGGGG No data
1062454940_1062454949 -7 Left 1062454940 9:136631639-136631661 CCCCAGGAGGGCCACCATGGATG No data
Right 1062454949 9:136631655-136631677 ATGGATGTCTGGGGCCGAGGAGG No data
1062454940_1062454955 16 Left 1062454940 9:136631639-136631661 CCCCAGGAGGGCCACCATGGATG No data
Right 1062454955 9:136631678-136631700 CACACAGCCACCCGGGGCCAGGG No data
1062454940_1062454952 9 Left 1062454940 9:136631639-136631661 CCCCAGGAGGGCCACCATGGATG No data
Right 1062454952 9:136631671-136631693 GAGGAGGCACACAGCCACCCGGG No data
1062454940_1062454954 15 Left 1062454940 9:136631639-136631661 CCCCAGGAGGGCCACCATGGATG No data
Right 1062454954 9:136631677-136631699 GCACACAGCCACCCGGGGCCAGG No data
1062454940_1062454958 26 Left 1062454940 9:136631639-136631661 CCCCAGGAGGGCCACCATGGATG No data
Right 1062454958 9:136631688-136631710 CCCGGGGCCAGGGAGCACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062454940 Original CRISPR CATCCATGGTGGCCCTCCTG GGG (reversed) Intergenic
No off target data available for this crispr