ID: 1062456708

View in Genome Browser
Species Human (GRCh38)
Location 9:136643247-136643269
Sequence CAGAATTATCAGATTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062456708_1062456712 1 Left 1062456708 9:136643247-136643269 CCACCTTCAATCTGATAATTCTG No data
Right 1062456712 9:136643271-136643293 GCAGAAAACTGAATATAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062456708 Original CRISPR CAGAATTATCAGATTGAAGG TGG (reversed) Intergenic
No off target data available for this crispr