ID: 1062459343

View in Genome Browser
Species Human (GRCh38)
Location 9:136656414-136656436
Sequence ATCAGGGCGTGGAGGGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062459343_1062459355 16 Left 1062459343 9:136656414-136656436 CCCAAGACCCTCCACGCCCTGAT No data
Right 1062459355 9:136656453-136656475 CTGAGGCAGACAAGCTTTCAGGG No data
1062459343_1062459353 -1 Left 1062459343 9:136656414-136656436 CCCAAGACCCTCCACGCCCTGAT No data
Right 1062459353 9:136656436-136656458 TCTGACACGTGGGGAAACTGAGG No data
1062459343_1062459356 25 Left 1062459343 9:136656414-136656436 CCCAAGACCCTCCACGCCCTGAT No data
Right 1062459356 9:136656462-136656484 ACAAGCTTTCAGGGCACCTATGG No data
1062459343_1062459350 -10 Left 1062459343 9:136656414-136656436 CCCAAGACCCTCCACGCCCTGAT No data
Right 1062459350 9:136656427-136656449 ACGCCCTGATCTGACACGTGGGG No data
1062459343_1062459354 15 Left 1062459343 9:136656414-136656436 CCCAAGACCCTCCACGCCCTGAT No data
Right 1062459354 9:136656452-136656474 ACTGAGGCAGACAAGCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062459343 Original CRISPR ATCAGGGCGTGGAGGGTCTT GGG (reversed) Intergenic
No off target data available for this crispr