ID: 1062459637

View in Genome Browser
Species Human (GRCh38)
Location 9:136657507-136657529
Sequence ACCAGGGCATGGAGGGTCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062459637_1062459648 16 Left 1062459637 9:136657507-136657529 CCGAAGACCCTCCATGCCCTGGT No data
Right 1062459648 9:136657546-136657568 CTGAGGCAGAGAAGCCTTCAGGG No data
1062459637_1062459646 -1 Left 1062459637 9:136657507-136657529 CCGAAGACCCTCCATGCCCTGGT No data
Right 1062459646 9:136657529-136657551 TCTGACACGAGGGGAAACTGAGG No data
1062459637_1062459643 -10 Left 1062459637 9:136657507-136657529 CCGAAGACCCTCCATGCCCTGGT No data
Right 1062459643 9:136657520-136657542 ATGCCCTGGTCTGACACGAGGGG No data
1062459637_1062459649 25 Left 1062459637 9:136657507-136657529 CCGAAGACCCTCCATGCCCTGGT No data
Right 1062459649 9:136657555-136657577 AGAAGCCTTCAGGGCACCCATGG No data
1062459637_1062459647 15 Left 1062459637 9:136657507-136657529 CCGAAGACCCTCCATGCCCTGGT No data
Right 1062459647 9:136657545-136657567 ACTGAGGCAGAGAAGCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062459637 Original CRISPR ACCAGGGCATGGAGGGTCTT CGG (reversed) Intergenic
No off target data available for this crispr