ID: 1062459981

View in Genome Browser
Species Human (GRCh38)
Location 9:136658985-136659007
Sequence GAGCCTCGGGGGTCGCCCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062459981_1062459991 0 Left 1062459981 9:136658985-136659007 CCCCCGGGCGACCCCCGAGGCTC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1062459991 9:136659008-136659030 AGGCGCCCGGACTCCAGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 133
1062459981_1062459999 29 Left 1062459981 9:136658985-136659007 CCCCCGGGCGACCCCCGAGGCTC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1062459999 9:136659037-136659059 GTTTTCCACCCTTGAACAAGCGG 0: 1
1: 0
2: 0
3: 7
4: 111
1062459981_1062459992 1 Left 1062459981 9:136658985-136659007 CCCCCGGGCGACCCCCGAGGCTC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1062459992 9:136659009-136659031 GGCGCCCGGACTCCAGTCCTGGG 0: 1
1: 0
2: 2
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062459981 Original CRISPR GAGCCTCGGGGGTCGCCCGG GGG (reversed) Exonic
900372904 1:2340145-2340167 CAGCCTCCGAGGTCTCCCGGAGG - Intronic
900427195 1:2586258-2586280 GAGCGGCGGGGGTCTCCCTGCGG - Intergenic
901602147 1:10430671-10430693 CAGCCGCGGGGGGCGCCCGGGGG - Intronic
902794536 1:18792643-18792665 AAGCCTCGGGTGTGGCCCGATGG - Intergenic
905417070 1:37811235-37811257 GAGCCTGAGGGGGCGCCCTGGGG + Exonic
919931692 1:202225325-202225347 GAGCCTCGGAGGTCCCTCGAGGG + Intronic
922739375 1:228006886-228006908 GCGCCGCGGGGGGCGCCCGCCGG - Intergenic
924801657 1:247332452-247332474 GAGCCTCGGGGCTTGCGCAGAGG + Intergenic
1063115031 10:3067230-3067252 GAGCCTCGCGGGTGGGCTGGAGG - Intronic
1065066829 10:21976883-21976905 GAGCCTAGTGGGTGGGCCGGCGG - Intronic
1065636986 10:27743451-27743473 GAGCCTCGGGGCTGGGCCGCCGG + Exonic
1072706923 10:97687444-97687466 GCGCCTCGGGCGCCGCGCGGGGG - Intergenic
1076839633 10:133039647-133039669 GAGCCCCGGGGGCAGCACGGAGG - Intergenic
1076998567 11:311078-311100 CCCCCTCGGGGGTCTCCCGGAGG + Intronic
1077000176 11:318681-318703 CCCCCTCGGGGGTCTCCCGGAGG - Intergenic
1077032828 11:477404-477426 GGGCCTGGGGGGTGGCCCTGGGG + Intronic
1077085241 11:747009-747031 GAGCGGCGGGGGACGCCCTGCGG - Intergenic
1084083276 11:66843048-66843070 GAGCCTCGGAAGCCGCCTGGAGG + Exonic
1089479389 11:118792101-118792123 GCGCCTCGGGGGTCTGCGGGGGG + Intergenic
1089494711 11:118902290-118902312 GAGCCTAGGGGGCCCCCCGCTGG - Exonic
1202815186 11_KI270721v1_random:43840-43862 GAGCCACTGGGGCCGCCGGGAGG - Intergenic
1095038803 12:37421174-37421196 CAGCCTCAGGGGTTGCCTGGGGG - Intergenic
1095049233 12:37542004-37542026 CAGCCTCAGGGGTTGCCTGGGGG + Intergenic
1097024104 12:56041650-56041672 GAGCCCAGGGCGTCCCCCGGTGG + Intergenic
1098556598 12:71825669-71825691 GAGCCTCGTGGGTTTCCTGGAGG - Intergenic
1102278118 12:111598617-111598639 GAGCCCCGAGGCTCGGCCGGTGG - Intronic
1102688910 12:114745086-114745108 GAGCGTTGGGGGTCGCCGAGGGG + Intergenic
1103604707 12:122078413-122078435 GCGCCCCGGGAGTCGCCCTGTGG - Intergenic
1113484169 13:110642399-110642421 AGGCCACGGGGGACGCCCGGCGG - Exonic
1124014716 15:25864839-25864861 AGGCCTCGGGGGTCACCAGGTGG - Intronic
1130551636 15:84893285-84893307 GAGGCTCCGTGGTCGCCAGGAGG - Intronic
1131437771 15:92436845-92436867 GAGCCTCCGGGGCAGCCAGGGGG - Intronic
1133115894 16:3577774-3577796 GAGCCACAGGGGTGGCCTGGAGG - Intergenic
1133350503 16:5097842-5097864 GGGGCCCGGGGGTCCCCCGGGGG + Intergenic
1135691279 16:24539801-24539823 GAGCCTCGGCGGTGTCCCCGGGG + Intronic
1143140574 17:4739846-4739868 GAGCCTCCCGGGCGGCCCGGTGG + Intronic
1144339372 17:14299670-14299692 CAGCCCCGGGGGTCGCGCTGGGG + Intergenic
1144443841 17:15308626-15308648 AAGGCTCGGGGCTCGCTCGGAGG - Intronic
1147179101 17:38673829-38673851 GAGCCTCGGGGGCGGCCGGCGGG + Exonic
1147583374 17:41638930-41638952 AGGCCTCGGGGGTCACCCGTGGG + Intergenic
1148652561 17:49260376-49260398 GAAGCTTGGGGGACGCCCGGCGG - Intergenic
1150236978 17:63601165-63601187 GAGGGCCGGGGGTCGCGCGGAGG - Exonic
1150480249 17:65503741-65503763 GAGCCTTGGGAGTCTCCTGGTGG - Intergenic
1151413660 17:73947641-73947663 GAGCCTCGTGGGCTGCCAGGAGG + Intergenic
1151620653 17:75242959-75242981 GAGCCTCTGGGGTTTCCCTGGGG - Intronic
1152021529 17:77782254-77782276 GTGCCTCGTGGGTCCCCTGGGGG - Intergenic
1152354244 17:79798994-79799016 GACCCTCGCGGGCCGCCCGTGGG + Intronic
1152628118 17:81397568-81397590 GAGCCCCGGAGGGCGCCGGGCGG - Intronic
1152870310 17:82750614-82750636 GAGCCTTGGGGATCTTCCGGTGG - Exonic
1153052190 18:909449-909471 GAGCCTCGGCGGCGGCGCGGGGG + Exonic
1157794354 18:50560415-50560437 GAGCGGCGGGGGTCTCCCGCGGG + Intronic
1160972673 19:1776358-1776380 GCGCCGCTGGGGCCGCCCGGAGG + Exonic
1161489173 19:4552453-4552475 CAGCCTCGGGGGCCGGCCCGTGG - Exonic
1162030709 19:7916206-7916228 GAGTCCCAGGGGTCGCCAGGGGG + Exonic
1163585433 19:18161188-18161210 GAGCCTGGCGGGTAGCCCGGGGG + Intronic
1164594751 19:29525835-29525857 TCTCCTCGGGGGTCGCTCGGAGG - Intergenic
1165596212 19:37012713-37012735 CAGCCTCAGGGGTTGCCTGGGGG + Intronic
1167557064 19:50203353-50203375 GAGGCGCGGGGGGCGGCCGGGGG - Intronic
1167594355 19:50419235-50419257 GAGCCACGGAGGACGCCCGCAGG - Intronic
1168153341 19:54460589-54460611 GGGGCTCGGGGGGGGCCCGGGGG - Intronic
933776845 2:85776252-85776274 GAGCTTCAGGGGTTGCCTGGCGG + Intronic
934554931 2:95282091-95282113 GAGCCTTGGGGGTGGCGGGGGGG - Intronic
938934528 2:136116924-136116946 GAGCCTGGCGTGTCGCCCAGCGG - Intronic
942044911 2:172094709-172094731 GAGCCTAGGCGGTCGCGGGGCGG - Intergenic
948121474 2:235534165-235534187 GAGCCACCGGGGTCGGCAGGAGG - Intronic
948449466 2:238060497-238060519 GGGCCCCGGGGGTCTCCCGCAGG - Intronic
948894670 2:240922547-240922569 GAGCCTCGGTGGTCTCCAGCCGG - Exonic
1168804432 20:664175-664197 GAGACGCGGGGGGCGCCGGGGGG - Exonic
1170816855 20:19721142-19721164 GAGCCTCTGTGGGCACCCGGCGG - Exonic
1171533155 20:25865466-25865488 CAGCCTCAGGGGTTGCCTGGGGG - Intronic
1171807210 20:29690182-29690204 CAGCCTCAGGGGTTGCCTGGGGG + Intergenic
1171837154 20:30167986-30168008 CAGCCTCAGGGGTTGCCTGGGGG - Intergenic
1171847525 20:30286171-30286193 CAGCCTCAGGGGTTGCCTGGTGG - Intergenic
1176103969 20:63377063-63377085 CGGCCCCGGTGGTCGCCCGGGGG - Intronic
1176555528 21:8252707-8252729 GAGCCGCGGGGATCGCCGGAGGG + Intergenic
1176679582 21:9812291-9812313 GAGCCTCAGGGGTTGCCTGGGGG - Intergenic
1176680157 21:9815110-9815132 GATCCTCAGGGGTTGCCTGGGGG - Intergenic
1176680440 21:9816519-9816541 GATCCTCAGGGGTTGCCTGGGGG - Intergenic
1176680723 21:9817928-9817950 GATCCTCAGGGGTTGCCTGGGGG - Intergenic
1176681006 21:9819331-9819353 GAGCCTCAGGGGTTGCCTGGGGG - Intergenic
1176681574 21:9822159-9822181 GATCCTCAGGGGTTGCCTGGGGG - Intergenic
1176682134 21:9824970-9824992 GAGCCTCAGGGGGTGCCTGGGGG - Intergenic
1176682413 21:9826379-9826401 GAGCCTCAGGGGGTGCCTGGGGG - Intergenic
1176682691 21:9827798-9827820 GAGCCTCAGGGGGTGCCTGGGGG - Intergenic
1176682971 21:9829195-9829217 GAGCCTCAGGGGGTGCCTGGGGG - Intergenic
1176683251 21:9830605-9830627 GAGCCTCAGGGGGTGCCTGGGGG - Intergenic
1176683530 21:9832014-9832036 GAGCCTCAGGGGGTGCCTGGGGG - Intergenic
1176683810 21:9833417-9833439 GAGCCTCAGGGGGTGCCTGGGGG - Intergenic
1176684087 21:9834826-9834848 GAGCCTCAGGGGGTGCCTGGGGG - Intergenic
1176684367 21:9836227-9836249 GAGCCTCAGGGGGTGCCTGGGGG - Intergenic
1176684654 21:9837628-9837650 GAGCCTCAGGGGTTGCCTGGGGG - Intergenic
960968414 3:123121627-123121649 GAGTCTGGAGGGTCGCCAGGAGG + Intronic
962575374 3:136751641-136751663 GGGCCTGGGGGGTCGCTCGGCGG - Intronic
966402731 3:179563395-179563417 GAGCCTCGGGGCTGGGCGGGAGG + Intronic
968809393 4:2793164-2793186 GGGTCTCGGGGGTCTCGCGGGGG + Intronic
969606207 4:8203489-8203511 GAGCCTCGGGGGAGGGCTGGGGG + Intronic
983533131 4:168832035-168832057 GAGCCTCCTGAGTCACCCGGCGG + Intronic
987006826 5:13718978-13719000 GAGCCTCGGTGGTCATCCAGAGG + Exonic
987023776 5:13902381-13902403 GAGCCTGGGGGGTGGCACTGGGG + Intronic
997196080 5:131980890-131980912 GAGCCTCGGGGGCTGCGCTGTGG - Intronic
1001641027 5:173244331-173244353 GAGCCGCGGAGGCTGCCCGGTGG - Intergenic
1002091736 5:176810332-176810354 GAGCCTCAGGCATCGCCCAGAGG + Intergenic
1006411427 6:33876182-33876204 GAGACCTGGGGGTCTCCCGGTGG - Intergenic
1017497746 6:154995923-154995945 GAGGCTCCGAGGTCGCCGGGCGG - Intronic
1017816190 6:158018175-158018197 GAGACTCGGGGGTGAGCCGGTGG + Intronic
1018787879 6:167122147-167122169 GAGCCTCGTGGGCAGCCTGGGGG + Intergenic
1019104187 6:169655647-169655669 CAGCCTCGGGGGTCTCCAGCTGG - Intronic
1019539438 7:1545188-1545210 GAGACACGGGGGCCGCCTGGTGG + Exonic
1023918282 7:44606861-44606883 GAGCCGCGGGGCCTGCCCGGCGG + Intronic
1024394275 7:48848123-48848145 GAGCCTCGGCGGGCGCGCGCGGG - Intergenic
1025295131 7:57770578-57770600 CAGCCTCAGGGGTTGCCTGGCGG + Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1034439949 7:151081362-151081384 GAGCCCCGGCGGTCGCAGGGCGG + Exonic
1034498232 7:151434302-151434324 GAGCGTTGGGGGTGGGCCGGGGG + Intronic
1038612655 8:29069977-29069999 GAGGCTGGGGGGTCCCCCAGAGG + Exonic
1045111443 8:98941651-98941673 GAGCCTCCTGGGTGGGCCGGGGG + Intronic
1051418748 9:16870557-16870579 GCGCCACCGGGGCCGCCCGGGGG - Intronic
1053022091 9:34701770-34701792 GAGCCTCGGGGGTCCTCTGCGGG + Intergenic
1053651915 9:40177573-40177595 GAGCCTCGGGAGACGCCAGCAGG - Intergenic
1053784486 9:41644357-41644379 CAGCCTCAGGGGTTGCCTGGTGG + Intergenic
1054160816 9:61671237-61671259 CAGCCTCAGGGGTTGCCTGGGGG - Intergenic
1054172443 9:61854490-61854512 CAGCCTCAGGGGTTGCCTGGTGG + Intronic
1054172919 9:61856928-61856950 CAGCCTCAGGGGTTGCCTGGGGG + Intergenic
1054447299 9:65383517-65383539 CAGCCTCAGGGGTTGCCTGGTGG + Intergenic
1054447777 9:65385962-65385984 CAGCCTCAGGGGTTGCCTGGGGG + Intergenic
1054664621 9:67723873-67723895 CAGCCTCAGGGGTTGCCTGGGGG - Intergenic
1054665097 9:67726315-67726337 CAGCCTCAGGGGTTGCCTGGTGG - Intergenic
1057024668 9:91725806-91725828 GAGCCCCGGGGCTTGCACGGAGG - Intronic
1059389174 9:113988156-113988178 GAGCCTCAGGGGTAGCCGTGGGG + Intronic
1060658330 9:125388044-125388066 GAGCCTCTGGGGTGGGCCTGGGG + Intergenic
1061011204 9:127955660-127955682 GAGCCTGGGGAGTAGCCAGGTGG + Intronic
1061256967 9:129459090-129459112 AAGCATCCGGGGTCCCCCGGGGG - Intergenic
1061289038 9:129640510-129640532 GAGCCCCGGGGGTGGGCAGGTGG - Intronic
1061881544 9:133571545-133571567 GAGGCTCTGGAGTCACCCGGAGG - Intronic
1062459981 9:136658985-136659007 GAGCCTCGGGGGTCGCCCGGGGG - Exonic
1203664752 Un_KI270754v1:14826-14848 GAGCCTCAGGGGCTGCCTGGGGG - Intergenic
1203665037 Un_KI270754v1:16235-16257 GATCCTCAGGGGTTGCCTGGGGG - Intergenic
1203666173 Un_KI270754v1:21871-21893 GATCCTCAGGGGTTGCCTGGGGG - Intergenic
1203666463 Un_KI270754v1:23278-23300 GAGCCTCAGGGGTTGCCTGGGGG - Intergenic
1203667322 Un_KI270754v1:27510-27532 GATCCTCAGGGGTTGCCTGGGGG - Intergenic
1203667612 Un_KI270754v1:28917-28939 GAGCCTCAGGGGTTGCCTGGGGG - Intergenic
1203668470 Un_KI270754v1:33149-33171 GATCCTCAGGGGTTGCCTGGGGG - Intergenic
1203668759 Un_KI270754v1:34556-34578 GAGCCTCAGGGGTTGCCTGGGGG - Intergenic
1203669036 Un_KI270754v1:35966-35988 GATCCTCAGGGGTTGCCTGGGGG - Intergenic
1203669314 Un_KI270754v1:37375-37397 GATCCTCAGGGGTTGCCTGGGGG - Intergenic
1203669604 Un_KI270754v1:38782-38804 GAGCCTCAGGGGTTGCCTGGGGG - Intergenic
1186888661 X:13938841-13938863 GACCCTCGGCGCTCGCCCGGGGG - Intergenic
1198083385 X:133260966-133260988 GAGCCTTGGGGGAGGCCTGGAGG - Intergenic