ID: 1062461927

View in Genome Browser
Species Human (GRCh38)
Location 9:136665863-136665885
Sequence CGCCCTCGACCCAGCCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 172}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062461927_1062461935 -2 Left 1062461927 9:136665863-136665885 CCGCCCGGGCTGGGTCGAGGGCG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062461935 9:136665884-136665906 CGGGACCCGCGGAGCCCCCGGGG No data
1062461927_1062461949 28 Left 1062461927 9:136665863-136665885 CCGCCCGGGCTGGGTCGAGGGCG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062461949 9:136665914-136665936 ACCTGGCCGCGCGCGGAGCTGGG No data
1062461927_1062461939 3 Left 1062461927 9:136665863-136665885 CCGCCCGGGCTGGGTCGAGGGCG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062461939 9:136665889-136665911 CCCGCGGAGCCCCCGGGGGCGGG No data
1062461927_1062461936 -1 Left 1062461927 9:136665863-136665885 CCGCCCGGGCTGGGTCGAGGGCG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062461936 9:136665885-136665907 GGGACCCGCGGAGCCCCCGGGGG No data
1062461927_1062461942 11 Left 1062461927 9:136665863-136665885 CCGCCCGGGCTGGGTCGAGGGCG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062461942 9:136665897-136665919 GCCCCCGGGGGCGGGGAACCTGG No data
1062461927_1062461934 -3 Left 1062461927 9:136665863-136665885 CCGCCCGGGCTGGGTCGAGGGCG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062461934 9:136665883-136665905 GCGGGACCCGCGGAGCCCCCGGG No data
1062461927_1062461951 29 Left 1062461927 9:136665863-136665885 CCGCCCGGGCTGGGTCGAGGGCG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062461951 9:136665915-136665937 CCTGGCCGCGCGCGGAGCTGGGG No data
1062461927_1062461947 21 Left 1062461927 9:136665863-136665885 CCGCCCGGGCTGGGTCGAGGGCG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062461947 9:136665907-136665929 GCGGGGAACCTGGCCGCGCGCGG No data
1062461927_1062461941 4 Left 1062461927 9:136665863-136665885 CCGCCCGGGCTGGGTCGAGGGCG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062461941 9:136665890-136665912 CCGCGGAGCCCCCGGGGGCGGGG No data
1062461927_1062461937 2 Left 1062461927 9:136665863-136665885 CCGCCCGGGCTGGGTCGAGGGCG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062461937 9:136665888-136665910 ACCCGCGGAGCCCCCGGGGGCGG No data
1062461927_1062461933 -4 Left 1062461927 9:136665863-136665885 CCGCCCGGGCTGGGTCGAGGGCG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062461933 9:136665882-136665904 GGCGGGACCCGCGGAGCCCCCGG No data
1062461927_1062461952 30 Left 1062461927 9:136665863-136665885 CCGCCCGGGCTGGGTCGAGGGCG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062461952 9:136665916-136665938 CTGGCCGCGCGCGGAGCTGGGGG No data
1062461927_1062461948 27 Left 1062461927 9:136665863-136665885 CCGCCCGGGCTGGGTCGAGGGCG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062461948 9:136665913-136665935 AACCTGGCCGCGCGCGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062461927 Original CRISPR CGCCCTCGACCCAGCCCGGG CGG (reversed) Intronic
900117036 1:1033323-1033345 CGCCCGCGGCCCCGCCCTGGCGG - Intronic
900325720 1:2107843-2107865 CTCCCTCGACACTGCCCTGGGGG - Intronic
903597043 1:24502894-24502916 CGCCCTAGTCCCAGCCCAGGGGG + Exonic
904261350 1:29289561-29289583 AGCCCCCTCCCCAGCCCGGGAGG + Intronic
904611395 1:31727996-31728018 CTCACCCCACCCAGCCCGGGGGG + Intronic
907888500 1:58616205-58616227 GGCCCTCATCCCAGCCTGGGCGG - Intergenic
908354415 1:63316990-63317012 GGCCCGCGACCCAGCCCGAATGG - Intergenic
921186740 1:212676889-212676911 TGCACTCCACCCAGCCTGGGTGG + Intergenic
1063565891 10:7172033-7172055 TGCCCTCGGCCCGGCCCCGGAGG - Exonic
1067227880 10:44387024-44387046 CGCCCTCGACTCAGCCCACGCGG - Intergenic
1067877866 10:50020533-50020555 AGCCCTCGCCCCAGCCCAGTAGG - Intergenic
1069769352 10:70887922-70887944 CGCCCCCGCCCCCGCCCCGGGGG + Intronic
1070132211 10:73663869-73663891 AGCCCTCGCCCCAGCCCAGTAGG + Intergenic
1071545034 10:86522222-86522244 CGCCCTCGACCTGGCCTGGTCGG + Intergenic
1074819557 10:117168170-117168192 CACCCTCGGCTCAGCCCCGGGGG - Intergenic
1075181466 10:120215354-120215376 CGGCCGCGACCCAGTCTGGGAGG - Intergenic
1075425661 10:122339858-122339880 CACCCTAGACCCCGCCCGGCAGG - Intergenic
1076099773 10:127766749-127766771 TGCCTTCCACCCAGCCCAGGTGG - Intergenic
1076146396 10:128125963-128125985 CGCCCTCGCCAGAGCCCAGGAGG + Intronic
1076781979 10:132729460-132729482 TGCCCTGGACCCCGCCAGGGAGG + Intronic
1076898575 10:133325923-133325945 CGCCGCCGCCCCAGCCTGGGTGG + Exonic
1076908213 10:133373599-133373621 CGCCCCCGCCCCAGCCCTCGGGG + Exonic
1077040150 11:517342-517364 CGCCCACTTCCCAGACCGGGCGG - Intergenic
1078316061 11:10294121-10294143 CGCCGCCCACCCGGCCCGGGAGG + Exonic
1081700141 11:45147355-45147377 CGCCCTCGGCCCCGCGCCGGGGG + Exonic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1084271224 11:68030376-68030398 CGCCCCCCACCCAACCCGGCGGG + Intergenic
1085022403 11:73217933-73217955 CGCCCCTGCCCCAGCCCGGCTGG - Intergenic
1085208142 11:74749303-74749325 CGCCCCCGTCCCGGCGCGGGCGG - Exonic
1085443313 11:76582501-76582523 CGGCCGCCACCCAGTCCGGGAGG - Intergenic
1086666610 11:89491391-89491413 CGGCGCCGAGCCAGCCCGGGCGG + Exonic
1088658975 11:112027251-112027273 CGGCCGCGACCCCGTCCGGGAGG - Intronic
1090635191 11:128686617-128686639 CGCCCAAGAACCAGCCTGGGAGG - Intronic
1091625051 12:2115336-2115358 GGCCATCGACGCAGCCCGGCAGG + Exonic
1096464549 12:51841088-51841110 TGCCCTCTTCCCAGCCCTGGGGG + Intergenic
1096791411 12:54047429-54047451 CGCCCCGGACCCAGGCCGCGAGG + Intronic
1096994322 12:55829520-55829542 CACCCTGGCCCCAGGCCGGGCGG - Exonic
1097228547 12:57495103-57495125 TGGCCGCCACCCAGCCCGGGAGG - Intronic
1097794096 12:63844128-63844150 CGCCCTGGGCACAGCCCCGGCGG - Intergenic
1102235773 12:111293625-111293647 CGTCCACGACCCAGCCAGGTGGG - Intronic
1103363961 12:120369210-120369232 CTCCCCCGACCCCGCTCGGGCGG + Intergenic
1103724673 12:122991752-122991774 CACACTCGGCACAGCCCGGGCGG + Intronic
1104763505 12:131312315-131312337 CGCCCTCTGCCCATCCCGGAAGG - Intergenic
1104815997 12:131645762-131645784 CGCCCTCTGCCCATCCCGGAAGG + Intergenic
1105517589 13:21104364-21104386 CTCCCGCGTCCCAGCCCGCGAGG - Intergenic
1114627944 14:24141510-24141532 CGCCCCCGGCCCAGTCCAGGAGG + Exonic
1117377457 14:55129332-55129354 CGCCCTCTCCCCTGCCCGGCCGG - Intronic
1119644430 14:76338265-76338287 GGCCCTGGCTCCAGCCCGGGTGG + Intronic
1120906530 14:89625632-89625654 CGCCCCACTCCCAGCCCGGGAGG + Intergenic
1122066231 14:99175911-99175933 GGCCCTCGCCGAAGCCCGGGTGG + Exonic
1122116737 14:99531363-99531385 CGCCCCCAGCCCAGCCCGGCTGG + Intronic
1122130828 14:99603982-99604004 CGCCCTCGCCCTCGCCCGGCCGG + Exonic
1122779382 14:104137276-104137298 CGCTTTCCACCCAGCCTGGGGGG - Intergenic
1125651437 15:41320967-41320989 CGGCCGCGACCCTGCCTGGGAGG + Intronic
1125689572 15:41585370-41585392 CGGCCTCGGCCAAGCCCCGGCGG - Intergenic
1125696789 15:41644621-41644643 TGCCCTCCAGCCAGCCTGGGTGG + Intronic
1129766087 15:78168748-78168770 CACCATCTACCCAGCCCAGGAGG - Exonic
1131466010 15:92655477-92655499 CGCCCCAGACCCAAACCGGGTGG + Exonic
1132565827 16:622364-622386 CCCCCTTGACCCCGCCCGCGAGG + Intronic
1132583066 16:694148-694170 CGCCCCCGGCCCAGCGCGGGAGG - Exonic
1132670848 16:1101801-1101823 CGCCCTCGACACAGCCCCAGGGG - Intergenic
1132933815 16:2471360-2471382 CGCCCACGGCCCTTCCCGGGAGG + Intergenic
1133802845 16:9098043-9098065 AGCCCCCGCCCCAGCCCTGGGGG - Intronic
1138346733 16:56324737-56324759 CGCCAACAACCCAGCCCGTGGGG - Intronic
1139925036 16:70481326-70481348 CACCCTTGGCCCAGCCAGGGAGG - Intronic
1140469165 16:75205057-75205079 GGGCCTCGGCCCTGCCCGGGTGG + Intronic
1140472619 16:75223882-75223904 GGGCCTCGGCCCTGCCCGGGTGG - Intronic
1141484554 16:84330157-84330179 AGCCCTGGAGCCAGCCCTGGTGG - Intergenic
1141632707 16:85297124-85297146 CGCCCTCTACCCGGCCAGGCTGG + Intergenic
1141639930 16:85335200-85335222 CTCCCTACACCCATCCCGGGAGG + Intergenic
1142261282 16:89043559-89043581 CGGCCCTGCCCCAGCCCGGGAGG - Intergenic
1142812568 17:2402051-2402073 CGCCCGCAGCCCAGACCGGGGGG + Intergenic
1143459742 17:7094599-7094621 CTCCCTTGACCCAGCCCTTGAGG - Intergenic
1145750176 17:27349601-27349623 CGCCCCCGCCCCAGGCCGCGAGG + Intergenic
1146061396 17:29609297-29609319 CACCCTTGAGCCAGCCCGGTGGG + Intronic
1149595565 17:57862692-57862714 AGCCCTGCACCCAGCCTGGGTGG - Exonic
1152287406 17:79421052-79421074 GGCCCTCGACCCACCTGGGGAGG - Intronic
1152463754 17:80454629-80454651 CGGCCTCGCGCCAGCCCGGCCGG + Intergenic
1152729132 17:81961268-81961290 CCCCCTCCGCCGAGCCCGGGCGG - Exonic
1154125617 18:11689671-11689693 GGCCCTGGCCCCAGTCCGGGCGG + Exonic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160220101 18:76969320-76969342 CGCACTCTGCCCAGCACGGGTGG - Exonic
1161400751 19:4065572-4065594 CGCCCTCCCCCCAGCCCGGGTGG - Intronic
1161752881 19:6110356-6110378 CGCCCCGGGCCCAGCCCGGCCGG - Intronic
1161934138 19:7360883-7360905 GTCCCTCCAACCAGCCCGGGAGG + Intronic
1162145562 19:8610839-8610861 AGCCCGCGGCCCAGGCCGGGCGG - Intergenic
1163158043 19:15449684-15449706 CGCCCCCGCCCCCGCCCCGGGGG + Intronic
1163607275 19:18281991-18282013 CGCCCCCGCCCCCGCCCGGCCGG - Intergenic
1163614392 19:18318238-18318260 GGCCCTCAACCCTGGCCGGGTGG + Intronic
1163829292 19:19540172-19540194 CGCCCTGGTCCCAGCGCGTGCGG + Intronic
1166437890 19:42785170-42785192 TGCCCTGGCCCCAGCCCAGGTGG + Intronic
1166456839 19:42948962-42948984 TGCCCTGGCCCCAGCCCGGGTGG + Intronic
1166466791 19:43039831-43039853 TGCCCTAGTCCCAGCCCGGGTGG + Intronic
1166472928 19:43095909-43095931 TGCCCTAGTCCCAGCCCGGGTGG + Intronic
1166486592 19:43219460-43219482 TGCCCTGGCCCCAGCCCGGGTGG + Intronic
1167752023 19:51387241-51387263 CGGCCTGGACCCTGGCCGGGGGG + Exonic
926185924 2:10690521-10690543 CTGCCTCGCCCCCGCCCGGGAGG - Intergenic
926207737 2:10846001-10846023 CACCCTTGTCCCAGCCCTGGGGG + Intergenic
928373556 2:30758071-30758093 CGGCCTCGCCCCAGCCCCAGGGG + Exonic
929445176 2:41995576-41995598 CGGCCGCGACCCCGTCCGGGAGG + Intergenic
934655750 2:96116241-96116263 CGCCCTCGGCGCCGCCCGAGGGG - Exonic
934856874 2:97735110-97735132 CGCCTTGGTCCCAGCCTGGGTGG + Intronic
936218003 2:110576903-110576925 CGGCCTCGACCCGGCCGGGGGGG - Intronic
937096299 2:119237459-119237481 TGCCCTCCCCCCAGCCAGGGAGG + Intronic
943639703 2:190344232-190344254 CGCCCTTGGCCCTGCCCGAGCGG + Intronic
943692311 2:190881246-190881268 CGCCCCCGCCCCACCACGGGTGG - Exonic
946692327 2:222319208-222319230 CGCCCTCGCCCTCGCCCGTGGGG - Intergenic
947592875 2:231395432-231395454 CGCCCTCCCCCCGCCCCGGGAGG + Intergenic
948206368 2:236164639-236164661 CCCCCTCGACCCCGCCCGGAGGG + Intergenic
948207260 2:236168704-236168726 CGCCCCCGGCCCAGCCGTGGGGG - Intergenic
948885234 2:240878930-240878952 AGCCACTGACCCAGCCCGGGAGG + Exonic
1168790308 20:571890-571912 CGCCCTCGCCCCACCCTGGCCGG + Intergenic
1169193935 20:3673546-3673568 CTCCCTCGCCCCCGCCCGCGGGG + Intronic
1171121502 20:22572655-22572677 CGCCCTGGCCCCAGCCCCCGCGG - Intergenic
1171974848 20:31587902-31587924 CGCCCTCGCCCCCGCCCGCCGGG + Intergenic
1172666810 20:36605917-36605939 CGCCCCAGGCCCGGCCCGGGCGG + Exonic
1172918596 20:38461852-38461874 CGGCCGCGACCCTGTCCGGGAGG - Intergenic
1174174502 20:48636391-48636413 CTCCCTCGACCCGGCCTGGGCGG + Intronic
1174804271 20:53593209-53593231 CGCCCTCCGCCCGGCCCGAGTGG + Intronic
1175320536 20:58084712-58084734 CTCCCTCCACACAGCCCGTGGGG + Intergenic
1175883898 20:62277341-62277363 CCCGCTCTACCCAGCCCAGGCGG - Intronic
1176654968 21:9579847-9579869 GGCCCACGACCCAGCCCCAGAGG - Intergenic
1179893703 21:44350284-44350306 CGCCCTCGCCCCGGCCCCGGCGG - Intronic
1179913581 21:44462611-44462633 GACCCTCGCCCCAGCCTGGGAGG - Intergenic
1180179350 21:46111153-46111175 CCCACTCCACCCAGCCCTGGAGG + Intronic
1184265256 22:43342992-43343014 CCCCCTCCCCGCAGCCCGGGCGG - Intronic
1185055606 22:48576960-48576982 CGCTCCCGCCCCAGCCCGGCCGG - Intronic
1185258579 22:49849517-49849539 CGCCCTAGCCCCACCCCGGCCGG + Intergenic
1185271123 22:49929663-49929685 GGTCCCCGACCCAGGCCGGGCGG - Intergenic
1185385614 22:50530204-50530226 CGCCCGAGACCCACGCCGGGCGG - Intronic
949977878 3:9477286-9477308 AGCCCTGGAGCCAGCCCAGGTGG + Exonic
950438757 3:12995084-12995106 CGCCCTCGCTCCAGACCGGCGGG - Intronic
953257654 3:41306192-41306214 AGCCCCCCACCCCGCCCGGGAGG + Intronic
954612948 3:51955875-51955897 CGCACGCGGCCCAGCCCGGGCGG - Exonic
961539689 3:127591074-127591096 CGGCCGCGGCCCAGGCCGGGAGG - Intronic
962498454 3:135965891-135965913 CTCCCTCGTCCCGGCCCGAGGGG + Intronic
962874623 3:139526389-139526411 GGCCCGCAACCCAGCCTGGGGGG + Intronic
963015322 3:140819033-140819055 AGCCCTCAGCCCAGCCAGGGAGG + Intergenic
966868523 3:184275955-184275977 CACCCTCCCCCCACCCCGGGCGG + Intronic
968434144 4:576309-576331 CGCCCCCTCCCCAGCCCGCGGGG + Intergenic
968829986 4:2928352-2928374 AGCCCCAGACCCAGCCCCGGTGG + Exonic
972396518 4:38663730-38663752 CGCCGCCGCCCGAGCCCGGGGGG - Intergenic
976765500 4:88593211-88593233 CGCCCCCGGCCCCGCCCAGGAGG - Intronic
984992628 4:185396232-185396254 CGCCCGCCTCCCAACCCGGGAGG - Intronic
985587819 5:750090-750112 CGCACTGCACACAGCCCGGGTGG - Intronic
985602484 5:842557-842579 CGCACTGCACACAGCCCGGGTGG - Intronic
986438104 5:7755165-7755187 CGCCCTCGGCCCAGCTCTGCAGG - Intronic
989147052 5:38259010-38259032 CGCCCTCCCCCGAGCCCGGGCGG + Intronic
993491594 5:88558306-88558328 TTCCCCCGACCCACCCCGGGTGG + Intergenic
996065105 5:119071185-119071207 CGCTCCTGACCCAGCCCGAGTGG - Intronic
998119158 5:139561747-139561769 CGCCCCCGTCCCCGCCCCGGGGG + Exonic
998129985 5:139646971-139646993 GGGCCTTGACCCAGCCGGGGTGG - Intergenic
1002052869 5:176581477-176581499 GGCCATCGACCCCGCCCTGGAGG + Exonic
1002705875 5:181160665-181160687 CGACCTGGCCCCAGCCCTGGGGG - Intergenic
1006320142 6:33315194-33315216 CGGCCCCGACCCCGCCCAGGCGG + Exonic
1007701776 6:43770117-43770139 CGCCCCCGGCCCGCCCCGGGGGG - Intergenic
1010244801 6:73653515-73653537 CGCCCCCGCCCCCGCCCGGTGGG + Intronic
1011418976 6:87152297-87152319 CGCCCTCGCCCCAGCACGCGAGG - Intergenic
1018787155 6:167116984-167117006 CACCCTCCACCCACCGCGGGAGG - Intergenic
1019624894 7:2011106-2011128 CGCCATCGCCCCAGCCGGGGAGG - Intronic
1019734656 7:2644780-2644802 CCACCTCCACCCAGCCAGGGAGG - Intronic
1021958805 7:25852593-25852615 CGCCCCCGCCCCGGCTCGGGAGG + Intergenic
1024499827 7:50093161-50093183 CGCCCTTGGCCCAGCGCGGCGGG - Exonic
1025113029 7:56235464-56235486 GGCCCTCAACCCATCCTGGGAGG - Intergenic
1026534803 7:71230701-71230723 AGCCATGGACCCTGCCCGGGAGG + Intronic
1029525686 7:101092432-101092454 CGGCCGCGACCCAGTCTGGGAGG + Intergenic
1030692677 7:112551700-112551722 CGGCCTCGACCCCGTCTGGGAGG + Intergenic
1030907700 7:115206844-115206866 GACCCTTGACCCAGCCCTGGAGG + Intergenic
1031043413 7:116862442-116862464 CTCCCTCGACCCGGCCCTCGCGG - Intronic
1032021767 7:128410381-128410403 CTCTCTCGCCCCAGCGCGGGAGG - Intergenic
1038359727 8:26865012-26865034 CGCCTCCGCGCCAGCCCGGGAGG - Exonic
1039883838 8:41644467-41644489 GGCCCTGGAACCAGCCCGAGAGG - Intergenic
1049329983 8:142045360-142045382 GCCCCTCCAGCCAGCCCGGGAGG - Intergenic
1049434380 8:142579681-142579703 GGCCGTCCGCCCAGCCCGGGAGG - Intergenic
1050377261 9:4985580-4985602 CGCCCTCGAGCCCGCAGGGGCGG - Exonic
1050382418 9:5043113-5043135 AGCCCCCGACCCAGCCCCGCAGG + Intronic
1052259247 9:26493217-26493239 CGCCCTCTTCCCAGACGGGGCGG - Intergenic
1056579899 9:87883160-87883182 CACCCTCACCCCCGCCCGGGAGG + Exonic
1060192006 9:121599435-121599457 GGCCCGGGACCCAGCGCGGGCGG - Intronic
1060480876 9:124016182-124016204 CGGTCTCGTCCCCGCCCGGGGGG - Intronic
1060498510 9:124135074-124135096 CGCCTTGGACCCTGCCAGGGAGG + Intergenic
1061405580 9:130391522-130391544 GGCCCACAACCCAGCCGGGGAGG + Intronic
1061800824 9:133112666-133112688 CCTCCTCTACCCAGCCTGGGGGG + Intronic
1062101503 9:134730901-134730923 AGCCCCCGTCCCAGCCAGGGCGG - Intronic
1062338675 9:136083838-136083860 TGCCCTCAACCCAGCCAGGCCGG - Intronic
1062461927 9:136665863-136665885 CGCCCTCGACCCAGCCCGGGCGG - Intronic
1203632693 Un_KI270750v1:83300-83322 GGCCCACGACCCAGCCCCAGAGG - Intergenic
1187464919 X:19518613-19518635 TGCCCTCGTTCCAGCCCTGGCGG + Intergenic
1190171488 X:48115326-48115348 CGGCCGCGACCCAGTCTGGGAGG + Intergenic
1192477032 X:71452372-71452394 CGGCCGCGACCCAGTCTGGGAGG - Intronic