ID: 1062463668

View in Genome Browser
Species Human (GRCh38)
Location 9:136672103-136672125
Sequence ACCCGGGAGGAGGGCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 243}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062463668_1062463676 -9 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463676 9:136672117-136672139 CTCCCGGGTCTGGGCCCAGTGGG 0: 1
1: 0
2: 0
3: 14
4: 179
1062463668_1062463675 -10 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463675 9:136672116-136672138 CCTCCCGGGTCTGGGCCCAGTGG 0: 1
1: 0
2: 0
3: 27
4: 324
1062463668_1062463690 22 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463690 9:136672148-136672170 GGCTACCCAGGCTTGGGGGTCGG 0: 1
1: 0
2: 4
3: 54
4: 518
1062463668_1062463691 23 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463691 9:136672149-136672171 GCTACCCAGGCTTGGGGGTCGGG 0: 1
1: 0
2: 1
3: 13
4: 305
1062463668_1062463687 16 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463687 9:136672142-136672164 TAGAGGGGCTACCCAGGCTTGGG 0: 1
1: 0
2: 1
3: 6
4: 98
1062463668_1062463684 10 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463684 9:136672136-136672158 TGGGCCTAGAGGGGCTACCCAGG 0: 1
1: 0
2: 1
3: 21
4: 154
1062463668_1062463681 1 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463681 9:136672127-136672149 TGGGCCCAGTGGGCCTAGAGGGG 0: 1
1: 0
2: 1
3: 26
4: 191
1062463668_1062463688 17 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463688 9:136672143-136672165 AGAGGGGCTACCCAGGCTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 211
1062463668_1062463692 24 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463692 9:136672150-136672172 CTACCCAGGCTTGGGGGTCGGGG 0: 1
1: 0
2: 0
3: 19
4: 295
1062463668_1062463686 15 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463686 9:136672141-136672163 CTAGAGGGGCTACCCAGGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 116
1062463668_1062463693 25 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463693 9:136672151-136672173 TACCCAGGCTTGGGGGTCGGGGG 0: 1
1: 0
2: 2
3: 25
4: 331
1062463668_1062463689 18 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463689 9:136672144-136672166 GAGGGGCTACCCAGGCTTGGGGG 0: 1
1: 0
2: 0
3: 24
4: 290
1062463668_1062463679 -1 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463679 9:136672125-136672147 TCTGGGCCCAGTGGGCCTAGAGG 0: 1
1: 0
2: 2
3: 21
4: 204
1062463668_1062463680 0 Left 1062463668 9:136672103-136672125 CCTCCAGAGCCCTCCTCCCGGGT 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1062463680 9:136672126-136672148 CTGGGCCCAGTGGGCCTAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062463668 Original CRISPR ACCCGGGAGGAGGGCTCTGG AGG (reversed) Intronic