ID: 1062464649

View in Genome Browser
Species Human (GRCh38)
Location 9:136675670-136675692
Sequence CTGGGAGAGCAGAGGGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1482
Summary {0: 1, 1: 1, 2: 16, 3: 150, 4: 1314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062464649_1062464664 29 Left 1062464649 9:136675670-136675692 CCGTCTCCCCTCTGCTCTCCCAG 0: 1
1: 1
2: 16
3: 150
4: 1314
Right 1062464664 9:136675722-136675744 AGGGAAGTGACATCAGCCCCAGG No data
1062464649_1062464656 9 Left 1062464649 9:136675670-136675692 CCGTCTCCCCTCTGCTCTCCCAG 0: 1
1: 1
2: 16
3: 150
4: 1314
Right 1062464656 9:136675702-136675724 AGCCCTCACTCTGCCCCCAAAGG No data
1062464649_1062464657 10 Left 1062464649 9:136675670-136675692 CCGTCTCCCCTCTGCTCTCCCAG 0: 1
1: 1
2: 16
3: 150
4: 1314
Right 1062464657 9:136675703-136675725 GCCCTCACTCTGCCCCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062464649 Original CRISPR CTGGGAGAGCAGAGGGGAGA CGG (reversed) Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900227243 1:1539203-1539225 CTGGGGGGGCAGCGGGGAGGTGG - Intronic
900603172 1:3511855-3511877 CTTGGTGAGCAGAGGGTCGAGGG - Intronic
900608742 1:3535590-3535612 ATGTGAGGGCAGAGGGGAGGTGG - Intronic
900675228 1:3881182-3881204 ATGGGGGAGGACAGGGGAGAAGG + Intronic
900897886 1:5496510-5496532 CTGGCAGAGCAGATGGGAGAGGG + Intergenic
901372881 1:8815712-8815734 TTGGGAGAGAAGAGAGAAGATGG - Intronic
901748091 1:11388034-11388056 CTGGGAGAGCCGGGGAGAGACGG - Intergenic
901769070 1:11521400-11521422 CTGGGAGGGGAGAGGAGGGAAGG + Intronic
901769145 1:11521628-11521650 CTGGGAGGGGAGAGGAGGGAAGG + Intronic
901784527 1:11616097-11616119 CTGAGGGAGCAGAGGGCAGTGGG - Intergenic
901860405 1:12070671-12070693 GTGGGAGCGCAGAGGGCAGGAGG + Intronic
902252291 1:15162030-15162052 GTGAGAGAGAAGAGGAGAGAAGG + Intronic
902255563 1:15186785-15186807 CTCTGAGAGCAGTGGAGAGAGGG + Intronic
902431722 1:16368042-16368064 TTGGGAGAGGAGTGGGGAGATGG + Intronic
902629048 1:17694002-17694024 CTGGGAGTGCAGGGGGCAGGAGG - Intronic
902653958 1:17854700-17854722 GTAGGAGGGCAGAGGGGAGAAGG - Intergenic
902973411 1:20071563-20071585 CTGGGAGAGCTCAGGGCAGGGGG + Intronic
903139735 1:21332283-21332305 CTGGGAACGCAGAGGTGAAAAGG + Intronic
903231601 1:21925713-21925735 CTGGGAGGGCTGTGTGGAGAAGG - Intronic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
903331229 1:22598128-22598150 CTGGGCGGGCAGTAGGGAGAGGG - Intronic
903562097 1:24235994-24236016 CTGGGAGGGCAGTCGGGAGAGGG + Intergenic
903652682 1:24930957-24930979 AGGGGAGAGCAGAGAGGAAAGGG - Intronic
903829257 1:26164824-26164846 CTGGGAAAGCAGGTGGGAGCGGG + Intergenic
903860078 1:26359923-26359945 CCGGGAGAGGTGAGGAGAGATGG - Intergenic
904067136 1:27762072-27762094 GTGGGTGAGGAGTGGGGAGAAGG - Intronic
904345519 1:29866315-29866337 TTCTGGGAGCAGAGGGGAGAGGG - Intergenic
904397276 1:30230305-30230327 CTTGGAGAACAGAGGTGGGAGGG - Intergenic
904653659 1:32025754-32025776 AAGGGAGAGAGGAGGGGAGAGGG - Intronic
905031044 1:34884924-34884946 CTGGGAGACAGGAGGAGAGAGGG - Intronic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905037124 1:34925518-34925540 AGGGGAGGGGAGAGGGGAGAGGG + Intronic
905274596 1:36809029-36809051 CTGGGAAAGCAGAAGAGACAAGG - Intronic
905304312 1:37007003-37007025 CTTGCACAGCAGAGGGAAGACGG - Intronic
905673290 1:39807606-39807628 GGGAGAGGGCAGAGGGGAGAGGG - Intergenic
906037099 1:42757700-42757722 GTGGGGTAGCAGAGGGGAGTAGG - Intronic
906040814 1:42786503-42786525 CTGGGAGAGCTGAGCAGAGCTGG + Intronic
906209618 1:44005212-44005234 CAGGGACCGCAGAGGTGAGAAGG + Intronic
906266673 1:44436282-44436304 CTGGGAGGACAGAGTGGAGCTGG + Intronic
906685066 1:47757820-47757842 CTGGCAGAGCAGATGGGGGTGGG + Intergenic
906748158 1:48235914-48235936 AGGGCAGGGCAGAGGGGAGAGGG - Intronic
907285218 1:53375741-53375763 CTGGGAGAACAGAGCGGATGAGG + Intergenic
907303712 1:53502752-53502774 GGGAGAGAGGAGAGGGGAGAGGG + Intergenic
907303791 1:53502983-53503005 CAGGGAGAGAGGAGGGGGGAAGG + Intergenic
907332134 1:53678309-53678331 CTGGGAGTGCAGGAGGGTGAGGG + Intronic
907583679 1:55594996-55595018 CTGAGGCAGCAGAGGAGAGAGGG + Intergenic
907864835 1:58389762-58389784 CTGGCAGGGGAGAGAGGAGAGGG + Intronic
908096249 1:60741991-60742013 TTGGGAGAGAAGAGGGAAGGTGG - Intergenic
908472317 1:64456207-64456229 GTGGGAGACAAGAGGGCAGAGGG - Intergenic
908783557 1:67713479-67713501 CAGGGAGAGCAGGGTGGGGATGG + Intronic
908804530 1:67916612-67916634 CAAGTAGAGCAGTGGGGAGAAGG - Intergenic
908959956 1:69684901-69684923 CAGGGAGAGCAGAGCAGGGATGG - Intronic
909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG + Intronic
909338096 1:74499626-74499648 CTGGTAGATAAGAGGGGAGGGGG + Intronic
909344786 1:74572464-74572486 CTGAGAGAGAAGAGGTGACAAGG - Exonic
910429424 1:87146624-87146646 TTGGGAAAGCAGAGGAGATAAGG + Intronic
910721429 1:90290569-90290591 CGGGGAGAGCAGCAGGGAGGAGG + Intergenic
911154361 1:94624051-94624073 AGGAGAGAGCAGAGGGAAGAAGG + Intergenic
911164618 1:94713725-94713747 CTGGGAGAACAGAGAGAATAAGG - Intergenic
911222044 1:95258615-95258637 GTGGAAGAACAGAGGTGAGAAGG - Intergenic
911383529 1:97145970-97145992 CTGGGAGAGAAAAGGGAAAAAGG + Intronic
911537846 1:99122005-99122027 CTTAGAGAGGAGAGGGGAGGGGG + Intergenic
911767059 1:101690237-101690259 CTGGGAGAGCAGAACAGAGAAGG + Intergenic
911830950 1:102550859-102550881 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
912100712 1:106201320-106201342 CTGGGAGGACAGTGGGGAGGAGG - Intergenic
912493426 1:110075833-110075855 CTGGGAGAGCACAGGGGGCCTGG + Intergenic
913152432 1:116057907-116057929 TTGGGTGGGGAGAGGGGAGAAGG + Intronic
914815209 1:151058104-151058126 CTGGGAGGGAAGAGAAGAGAGGG + Exonic
914854970 1:151344155-151344177 CTGGGAGAGAAGAGTGGAATTGG + Intronic
915141232 1:153769869-153769891 CTGGGAGAGGAGAGGAGGGCAGG + Intronic
915306736 1:154984073-154984095 CTGGGACAGAAAAGGGGGGAGGG + Intronic
915446844 1:155978841-155978863 AGGGGAGGGCAGAGGGGAAAGGG - Intronic
915728599 1:158036847-158036869 CTGGGAGAGCAGATGAATGAGGG + Intronic
915837346 1:159188311-159188333 GGGCGAGAGGAGAGGGGAGAGGG - Intronic
915914096 1:159930941-159930963 ATGGTTGAGCAGAGGGGAGGTGG - Intronic
915981259 1:160421196-160421218 CTGGGGGAGAAGAGGAGAGGAGG + Intronic
916320682 1:163499795-163499817 CGGAGAGGGGAGAGGGGAGAGGG + Intergenic
916682810 1:167119829-167119851 CTTGGAGAGCATGGGGGAGGAGG + Intronic
916884056 1:169049809-169049831 CTGGAAGAGCAGACAGGAAAGGG + Intergenic
917058689 1:171013000-171013022 ATGAGAGAGAGGAGGGGAGAGGG - Intronic
917137496 1:171801761-171801783 GTGGAAGAGCAGAGGGCATAGGG - Intronic
918045580 1:180939100-180939122 CAGGCAGAGCTGGGGGGAGAAGG + Intronic
918215974 1:182392032-182392054 CCGGGAGGGCTGAGGGCAGAGGG + Exonic
918217028 1:182400700-182400722 GTGAGAGAGCAGTGGGCAGAAGG - Intergenic
918709206 1:187705718-187705740 CTGGAACAGCAGATGGGTGAGGG - Intergenic
919257448 1:195142354-195142376 AGAGGAGAGCAGAGGGGAGGAGG - Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919747132 1:201015857-201015879 CTGGGAGAGGAGAGGCTGGAGGG + Intronic
919751757 1:201042067-201042089 CTGAGAGTGCAGAGGGGGTATGG - Intronic
919782299 1:201228786-201228808 CTGGGAGGGAAGAGGAGAGGAGG + Exonic
919824211 1:201492341-201492363 CTGGGAGAACAGAAGGGCCAAGG - Intronic
919944103 1:202307371-202307393 CAGGGAGTGCAGGGTGGAGAAGG - Exonic
920216088 1:204362351-204362373 ATTGTAGAGCAGAGGAGAGACGG - Intronic
920415714 1:205798052-205798074 CTGAGAGGGCAGAGGTCAGAAGG + Intronic
920691935 1:208153909-208153931 CTGGGAGGGGAGATGGGAAAAGG - Intronic
920704536 1:208242050-208242072 CCTGGAGGTCAGAGGGGAGAGGG + Intronic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
920868762 1:209775574-209775596 GAGGGAGATCAGAGAGGAGAGGG - Intronic
920916642 1:210262923-210262945 CCGGGAGGGCAGAGCAGAGAGGG - Intergenic
921787144 1:219244445-219244467 CTGGTAGAGCACATGGCAGAGGG + Intergenic
921813861 1:219544951-219544973 GGGGGAGGGGAGAGGGGAGAGGG - Intergenic
921813875 1:219544979-219545001 GGGAGAGAGGAGAGGGGAGAGGG - Intergenic
921815970 1:219563789-219563811 CTTTGAGAAGAGAGGGGAGAAGG + Intergenic
922022099 1:221715927-221715949 GAGGGAGAGAAGAGTGGAGAAGG - Intronic
922287641 1:224183592-224183614 CTGGGCGAGGAGCGGGGGGAGGG + Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922467246 1:225852844-225852866 ATGGGAGAGCAGGGTGGAGGAGG + Intronic
922472781 1:225887125-225887147 CTGGGAGGGCTGAGGTCAGAGGG + Intronic
922507575 1:226135459-226135481 CTGGGAGAGGAGAGAGGTGCTGG - Intergenic
922716996 1:227882955-227882977 AGGGCAGAGAAGAGGGGAGAAGG + Intergenic
922746690 1:228048229-228048251 CTGGGAGAGCAGGAGGGAGAAGG - Intronic
922749831 1:228065115-228065137 GTGGGAGAGGAGAGGGCAGAGGG + Intergenic
922934245 1:229411382-229411404 CTAGGAGAGGAGAGAGGAGGAGG - Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923448672 1:234096273-234096295 CTGGGAGAGCCGAGGAAAAAGGG - Intronic
923875813 1:238045776-238045798 CTTGGGGAGAAGAGGGGAGAGGG + Intergenic
924112919 1:240717484-240717506 GTGTGAGTGCAGAGGGGAAATGG + Intergenic
924309095 1:242721338-242721360 CTGAGAAAGCGGAGGGCAGATGG + Intergenic
924566599 1:245203865-245203887 TTGCTAGAGCAGAGGGGAGCGGG + Intronic
924851032 1:247830681-247830703 CTCTGAGAGCAGAGGGGATTAGG - Intergenic
924928037 1:248702581-248702603 CTGGGAGAACAGAAGGGCTATGG - Intergenic
1062921850 10:1286127-1286149 TTGGGAGTGCAGATGGCAGAGGG + Intronic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1064008627 10:11717480-11717502 CTGGGAGAGAAGTGGCGACAGGG - Intergenic
1064146105 10:12827637-12827659 AGGAGAGAGGAGAGGGGAGAGGG - Intronic
1064266245 10:13827816-13827838 GTGGGAGAGGAGGAGGGAGAAGG + Intronic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1064780328 10:18830603-18830625 CTGGGAAGTGAGAGGGGAGAGGG + Intergenic
1065281574 10:24144319-24144341 CTTGTAGAGCAAAGGGCAGAGGG + Intronic
1065590794 10:27259204-27259226 CTGGGAGAGAAAAGGGGAGGGGG - Intergenic
1065722754 10:28642447-28642469 CAGAGAGGGGAGAGGGGAGAAGG - Intergenic
1065973589 10:30823889-30823911 GTGGGAGAACAGAGGAAAGATGG - Intronic
1066367746 10:34793209-34793231 ATGGGAGAGCCAAGAGGAGAGGG + Intronic
1066672705 10:37857413-37857435 CTGGGAGAGCCCGAGGGAGACGG - Exonic
1066994236 10:42549194-42549216 CTGGGAGCACAGCGGGGAAAAGG + Intergenic
1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG + Intergenic
1067079115 10:43203633-43203655 CTGGGAGAGCTGCTGGGAGGCGG - Intronic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067532663 10:47085752-47085774 CGGAGAGAGGAGTGGGGAGATGG + Intergenic
1067716455 10:48694498-48694520 CTGGGAGAGGAGACGGGTAAAGG - Intronic
1068813813 10:61287138-61287160 CTGGGAGAGAAAGGGAGAGAAGG - Intergenic
1069183795 10:65396821-65396843 CTGGGATAGGAGGGTGGAGATGG - Intergenic
1069445730 10:68471770-68471792 CTGTGAGCGGAGAGGGGGGAGGG - Exonic
1069578188 10:69545322-69545344 TGGGGAGATCAGAGGGGAGCAGG - Intergenic
1069613698 10:69792645-69792667 CTGGTAGAGCACAGGGCAGTGGG - Intergenic
1069755660 10:70773153-70773175 CTGAGAGAGCAGAGGAGGAACGG - Intronic
1069780122 10:70950160-70950182 GTGAGAAAGCAGTGGGGAGAGGG - Intergenic
1069789516 10:71010749-71010771 CTGGGAGGGCAAAGAGGACAAGG - Intergenic
1070180772 10:74011417-74011439 CTAGGAGAGTAGGGAGGAGAGGG - Intronic
1070742059 10:78909728-78909750 CTGGGACCACAGAGTGGAGAAGG + Intergenic
1070829527 10:79409924-79409946 CTGGGGGAGGAGGCGGGAGAAGG + Intronic
1071336487 10:84604664-84604686 CCAAGAGAGCAGAGGGGAGGGGG - Intergenic
1071416236 10:85444502-85444524 GTGTGAGAGGAGAGGGGAAAAGG - Intergenic
1071451787 10:85799706-85799728 TTGGGAGAGTAGTGGGGAGGTGG + Intronic
1071471712 10:85988177-85988199 TTGGGAGAGTAGTGGGGAGTGGG - Intronic
1071508308 10:86246080-86246102 CTGGGAGAGCAGAGCTGGGAAGG - Intronic
1071858051 10:89645318-89645340 CTGGGCTTGCAGAGAGGAGATGG + Exonic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1071977188 10:90967026-90967048 GTGGGAGAGAAGAGGAAAGATGG - Intergenic
1072454978 10:95567636-95567658 AGGGGAGAGGAGAGGGGAGGGGG + Intergenic
1072634876 10:97171405-97171427 CTTGGAGAGCAGATTGGAGAGGG - Intronic
1072686803 10:97542430-97542452 GTGGGAGAGCAGAGGGAGGGAGG - Intronic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1073323330 10:102628605-102628627 CTGGGGGAGCAGAGGAAAGTAGG + Intronic
1073474048 10:103741443-103741465 CTAGGACAGCAGGGGAGAGAGGG - Intronic
1073816190 10:107209973-107209995 GTGGGGGAGAAGAGGGGAGAGGG + Intergenic
1074116014 10:110458000-110458022 CTGGGTGTGGAGTGGGGAGAGGG + Intergenic
1074524674 10:114253254-114253276 GGGGGAGAGGAGGGGGGAGACGG - Intronic
1074678310 10:115878063-115878085 CTGAGAGGGCAGTGGGGAGAAGG - Intronic
1075221441 10:120588367-120588389 CTGGGAGGCAAGAGGGGAGCAGG - Intronic
1075345764 10:121680988-121681010 CTGGGATAGGGGAGGAGAGAAGG + Intergenic
1075512908 10:123086760-123086782 CTGGGAGCTCAGAGGAGTGAGGG + Intergenic
1075552865 10:123405963-123405985 CATTGAGAGCAGAGGGGAAAAGG - Intergenic
1075575155 10:123572609-123572631 AGGGGAGAGGAGAGGAGAGAGGG + Intergenic
1075575174 10:123572679-123572701 AGGGGAGAGGAGAGGAGAGAGGG + Intergenic
1075575179 10:123572698-123572720 AGGGGAGAGGAGAGGAGAGAGGG + Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076346038 10:129779872-129779894 CGGGAAGAGGAGAAGGGAGAGGG - Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076436927 10:130452944-130452966 CTGGCAGAGCAGGGGGCAGATGG - Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076484985 10:130810149-130810171 CTGTGAGAGCAGAGCTGAGAGGG - Intergenic
1076517746 10:131058119-131058141 CTGGAAGAGAAGAAGGGAGAGGG + Intergenic
1076633050 10:131863578-131863600 CTGGGAGAGCCGAAGGGAGAAGG + Intergenic
1076694079 10:132238601-132238623 CTGGGAAAGCATAGAGCAGACGG + Intronic
1076722669 10:132399496-132399518 CTTGCAAAGCAGAGGGGAGAGGG + Intronic
1076731819 10:132442962-132442984 CAGGCAGAGCAGAGGCAAGAAGG - Intergenic
1076732507 10:132445761-132445783 CTGGGAGGGCAGAGGACAGGTGG + Exonic
1076922432 10:133461295-133461317 CTGGGAGACCACAGGTCAGATGG - Intergenic
1077020588 11:415587-415609 CTGGGAGAGGGACGGGGAGAGGG - Intronic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077233662 11:1469713-1469735 CCGGGAGAGGAGGGGTGAGAGGG + Intronic
1077298161 11:1835603-1835625 GTGGGTGAACAGAGGTGAGAAGG + Intronic
1077411871 11:2407472-2407494 CCAGGAGAGCAGAGTGGACAGGG - Intronic
1077484261 11:2831696-2831718 AGGGGAGGGCAGCGGGGAGAAGG - Intronic
1077497340 11:2892576-2892598 CAGGGGGAGCAGAGAGGAAATGG - Intronic
1077613970 11:3661902-3661924 GTGGGAGAGCAGATGGTTGAGGG + Intronic
1077853608 11:6099782-6099804 GTGGGAGATCAGAGGGCAGCAGG - Intergenic
1078093930 11:8284924-8284946 TTGGGGGAGAAGATGGGAGAGGG - Intergenic
1078450307 11:11436071-11436093 CTGCGTGAGCAGAGAGGCGAGGG + Intronic
1078659701 11:13277393-13277415 GTGGGAGACCTGAGGGGAAAGGG + Intronic
1078860336 11:15240753-15240775 GTGGTAGAACAGAGGGAAGAGGG - Intronic
1079090057 11:17474666-17474688 CCAGGAGAGCAGAGGGAACACGG - Intronic
1079189310 11:18264744-18264766 AAGGGAGAGGGGAGGGGAGAGGG + Intergenic
1080007302 11:27423461-27423483 CCATCAGAGCAGAGGGGAGAAGG - Intronic
1080275957 11:30503719-30503741 ATGGGAGAATAGAGGGGAGAGGG - Intronic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1080542352 11:33280013-33280035 CTGGGGGAGCTGAGGGGAGGTGG + Intronic
1081677467 11:44979309-44979331 TTGAGAGGGCAGAGGGCAGAAGG + Intergenic
1081682699 11:45019371-45019393 CTGGGAGAGGAAAGGGCAGTCGG + Intergenic
1081739093 11:45425640-45425662 CTGGGAGAAATGAGGGGAGGAGG + Intergenic
1081863413 11:46347098-46347120 GTGCGAGAGCGGAGGGGAGGTGG + Intronic
1082609745 11:55282454-55282476 CAGGGAGAGAAGAAGGCAGAGGG - Intergenic
1082656938 11:55868071-55868093 CAGGGAGAGAAGAAGGCAGAGGG + Intergenic
1083039079 11:59668911-59668933 CAGGGAGCGGGGAGGGGAGAGGG + Exonic
1083171513 11:60926161-60926183 CGGGCAGAGCAGAGGAGAGGAGG + Intronic
1083209463 11:61174067-61174089 CTGGGAGACCAGAGTGGCCATGG + Intergenic
1083433872 11:62629685-62629707 CTGGGTGAGGAGAGAAGAGACGG + Intronic
1083573350 11:63771702-63771724 CTGGGAGAACGCTGGGGAGAGGG + Intergenic
1083650913 11:64204203-64204225 AAGGGAGAGCAGGGGAGAGAAGG + Exonic
1083804879 11:65067627-65067649 CTGGGCGGGCAGATGGGAGCGGG - Intronic
1083832743 11:65243330-65243352 CTGGGATTACAGAGAGGAGAAGG + Intergenic
1083846676 11:65338615-65338637 GTTGGAGAGCAGAATGGAGAAGG - Intronic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084095355 11:66907688-66907710 TTAGAAGAGCAGAGGGTAGAAGG - Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084332707 11:68439302-68439324 GTGGGACAGGACAGGGGAGAGGG - Intronic
1084515597 11:69636765-69636787 CTGGGAGAGGTGAGGGGAGGAGG - Intergenic
1084623105 11:70287257-70287279 CTGGGAGAGCAGGGAGGCGCTGG - Intronic
1084638676 11:70410987-70411009 CTGGGGGAGGAGTGGGGTGAGGG + Intronic
1085153021 11:74267319-74267341 CTGGGAGAGAACAGGGAAGAAGG + Intronic
1085186392 11:74579411-74579433 CAGGGACAGCAGAGGGGTGGTGG + Intronic
1085306671 11:75490312-75490334 CTGGGAGAGCTGAGAGGACAAGG + Exonic
1085403046 11:76245951-76245973 CTGGGAGGGGAGAGCAGAGAAGG + Intergenic
1085645388 11:78219160-78219182 CTGGCAGAGTAGAGAGGAGGTGG + Exonic
1085681085 11:78575450-78575472 GTTGGAGGGCAGAGGGAAGAGGG - Intergenic
1086142256 11:83512207-83512229 GGGGGAGAGAAGAGGGCAGAAGG - Intronic
1086307146 11:85493720-85493742 GTAGGAGAGAAGAGGGGAGGGGG + Intronic
1087177118 11:95106184-95106206 AGGGCAGAGAAGAGGGGAGATGG + Intronic
1087738803 11:101864240-101864262 CTGGGAGAGGAGATAGGAAAAGG - Intronic
1087880041 11:103405250-103405272 CTGGGAGAGAAAGGAGGAGAAGG + Intronic
1088442732 11:109889429-109889451 CTTCAAGAGCTGAGGGGAGAGGG - Intergenic
1088469151 11:110175668-110175690 AGTGGAGAGCAGTGGGGAGAGGG - Intronic
1088540760 11:110911273-110911295 CTGCTGGTGCAGAGGGGAGAGGG + Intergenic
1088823198 11:113474221-113474243 CTTGAAGAGCAGAGGTAAGAGGG - Intronic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1088896645 11:114083570-114083592 CTAAGAGGGCAGAGGGGAGAGGG - Intronic
1088907745 11:114167647-114167669 CTGGGAGAGCAGGAGGGGGCTGG - Intronic
1089354307 11:117839918-117839940 CTGGGGGAGCAAAGAGGTGACGG + Intronic
1089501951 11:118937505-118937527 CTGGTGGGGCAGAGGGGATAGGG - Intronic
1089677932 11:120102661-120102683 CTTGGAGAGCACTGGGGAGGAGG + Intergenic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1089873491 11:121697346-121697368 CTGGCAGAGCAGAGGGGAGAGGG - Intergenic
1089874739 11:121709185-121709207 CTGGGACAGCACAGGGGACACGG + Intergenic
1089913365 11:122126422-122126444 TTGGGAGAGCAGCTGGGAGCAGG + Intergenic
1089969580 11:122682013-122682035 CAGGGAGAACAGACAGGAGATGG - Intronic
1090029338 11:123194453-123194475 GTTGGAGAGGAAAGGGGAGAGGG - Intronic
1090423741 11:126592964-126592986 GTGGGAGGGCTGAGGGGAGCAGG + Intronic
1090594584 11:128307505-128307527 CTGGGAGCACAGAAAGGAGATGG + Intergenic
1090803644 11:130189539-130189561 CTGTGAGAGCAGAGGGCAAAGGG + Intronic
1090893114 11:130945107-130945129 ATGGGAGCCCAGAGGAGAGAGGG - Intergenic
1091044631 11:132314722-132314744 CTGGGCAAGAAGAGGGGAGAGGG + Intronic
1091145907 11:133280071-133280093 TTGGGAGTGCAGAGTGAAGATGG + Intronic
1091237830 11:134033519-134033541 CTGGGAGGGAAGAGGGTAGAGGG + Intergenic
1091308588 11:134557002-134557024 CTGAGAGACAGGAGGGGAGAAGG + Intergenic
1091342087 11:134823788-134823810 CTGGGGCAGCAGAGGAGAAAAGG - Intergenic
1091364309 11:135004983-135005005 TAGTGACAGCAGAGGGGAGAAGG - Intergenic
1091477780 12:793914-793936 CTGGAAGAGTTGAGGGGAAATGG - Intronic
1091916414 12:4274003-4274025 CGGGGAAAGCAGGAGGGAGAGGG + Exonic
1092161871 12:6319496-6319518 ATGGGAGCGCAGAGGGGAGGAGG + Intronic
1092310811 12:7350025-7350047 CTGGGAGCTCAGAGAAGAGAAGG - Intronic
1092403274 12:8196068-8196090 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1092779310 12:11970546-11970568 CTCGTAGAGCAGAGGAGTGAGGG - Intergenic
1092970533 12:13689950-13689972 AGAGGAGAGAAGAGGGGAGAAGG - Intronic
1093080246 12:14802709-14802731 GTGGGAGAGCAGCAGGGAGTAGG + Intronic
1093243134 12:16702094-16702116 CTGGGACAGCAGGAGGGAGAGGG + Intergenic
1094773588 12:33695196-33695218 CTAGGAGAGGGAAGGGGAGAGGG - Intergenic
1096307278 12:50488897-50488919 ATTGGAGAGAAGAGGAGAGATGG - Intergenic
1096319444 12:50598796-50598818 GGGGGAGAGGGGAGGGGAGAGGG - Intronic
1096466305 12:51848961-51848983 CTGGGCGAGCCCAGGGGAGGTGG - Intergenic
1096583369 12:52602648-52602670 CTGGGGGAGCAGAGGAGGGAAGG - Intergenic
1096653737 12:53075521-53075543 GTAGGAGAGCAGAAGGGACAGGG + Intronic
1096670713 12:53196821-53196843 CTGGGAGAGGAGAGGAATGAAGG + Intronic
1096710709 12:53452887-53452909 CTTGGATAACCGAGGGGAGAGGG + Intronic
1096785900 12:54017178-54017200 CTGGGAGAGAGGAGGGGCGGAGG - Intronic
1097268632 12:57760541-57760563 TTGGGAGAGGGGAGGGGACAAGG - Intergenic
1097861715 12:64524406-64524428 CTTGGAGGACAGAGGGAAGAGGG - Intergenic
1097896009 12:64825194-64825216 CTGGAAGGGTAGAGGGCAGACGG + Intronic
1097918251 12:65042639-65042661 CTGGAGGGGCAGAGGGGAGCAGG - Intergenic
1098009050 12:66031120-66031142 AAGGGGGAGCAGAGGGGAAATGG - Intergenic
1098254785 12:68606071-68606093 AGAGGAGAGGAGAGGGGAGACGG + Intergenic
1098431299 12:70422881-70422903 CTGGGAGCACAGAGTGGCGACGG + Intronic
1098513060 12:71341678-71341700 CTTGGAGAGCAGAAAGGAAATGG + Intronic
1098995736 12:77117401-77117423 CTTAGAGAGCAGGGGGAAGATGG - Intergenic
1099424298 12:82503597-82503619 AGAGGAGAGGAGAGGGGAGAGGG + Intergenic
1099431525 12:82591913-82591935 CTGGGAAAGTAGAGTGGAGTGGG + Intergenic
1099721741 12:86370899-86370921 GTGGGATGGCAGAGGGGTGAGGG + Intronic
1100140421 12:91612032-91612054 CTGGAAGATCAGAGGACAGAAGG - Intergenic
1100281194 12:93119977-93119999 CAGAGAGAACTGAGGGGAGATGG - Intergenic
1100718573 12:97330949-97330971 CGGGGATAACAGAGAGGAGAGGG + Intergenic
1100936264 12:99670782-99670804 CTGACAGAGAAAAGGGGAGATGG + Intronic
1101329853 12:103748940-103748962 CTGCAAGAGCAGAGGAGAGAGGG - Intronic
1101843168 12:108342162-108342184 CAAGGGGAGGAGAGGGGAGAGGG + Intergenic
1101858485 12:108463621-108463643 CTGGGAAGGCAGAGAGGAGGTGG - Intergenic
1101909457 12:108850632-108850654 CAGGGAGGGGAGATGGGAGAGGG + Intronic
1102068175 12:109996131-109996153 CCAGGAAAGCAGAGGGGAGCGGG + Intronic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102547569 12:113667661-113667683 CAGAGAGAAAAGAGGGGAGATGG - Intergenic
1102572623 12:113836248-113836270 CAGGAAGAGGACAGGGGAGATGG + Intronic
1102636774 12:114331486-114331508 CTGGGAGAGCAGAGGTGGTGAGG - Intergenic
1102687529 12:114736173-114736195 CTGGGAGAGTTGTGGGGAGTTGG + Intergenic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1103054584 12:117808688-117808710 ATGGGAGAGGAGAGGGGTGTAGG - Intronic
1103237461 12:119385293-119385315 CTGGGAGATCAAAGGTGATATGG + Intronic
1103921676 12:124402574-124402596 GGGGGAGGGCAGAGGGGAGTGGG + Intronic
1103980897 12:124736362-124736384 ATGGCAGGGCAGAGGGGAGCTGG - Intergenic
1104066854 12:125313611-125313633 AGGGGAAAGGAGAGGGGAGAGGG - Intronic
1104236120 12:126938075-126938097 CTGTAATAGCAGAGAGGAGAAGG + Intergenic
1104480799 12:129106266-129106288 GTGGGAGGGCGGAGGGGGGAGGG + Intronic
1104544492 12:129698714-129698736 AGGGGAGGGGAGAGGGGAGAAGG + Intronic
1104634221 12:130427595-130427617 CTGCCAGAGCAGAAGGGAGAGGG + Intronic
1104635895 12:130437676-130437698 CTGGGAGAGAACAGGGCTGAGGG + Intronic
1104940691 12:132393281-132393303 CTGGGAGAGCAGAGCAGGGCTGG - Intergenic
1104996865 12:132663576-132663598 CTGGGAGAGAAGAGGGGCTATGG + Intronic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1106013700 13:25848291-25848313 CTGGGAGGGGAGAGGCAAGATGG + Intronic
1106139759 13:27002332-27002354 CTGAAAGGGCAGAAGGGAGATGG + Intergenic
1106333067 13:28756945-28756967 CAGTGAGAGTAGAGGAGAGAAGG - Intergenic
1106415781 13:29544768-29544790 CGGCGAGGGCAGTGGGGAGAGGG + Intronic
1106877359 13:34088470-34088492 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1107629701 13:42330861-42330883 CTTGGAGAGAGGAGGCGAGATGG - Intergenic
1107835531 13:44409828-44409850 ATGGGAGAGCAGTGGGGAAAGGG + Intergenic
1108028792 13:46206689-46206711 CTGGGAGAGAAGTAGGGAGTTGG + Intronic
1108299725 13:49061610-49061632 AAGGGAGAGGGGAGGGGAGAGGG - Intronic
1108299745 13:49061651-49061673 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1108299751 13:49061663-49061685 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1108299757 13:49061675-49061697 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1108299763 13:49061687-49061709 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1108378217 13:49833369-49833391 ATGGGAGAGGAAAGGGGAGAGGG + Intergenic
1108447800 13:50526847-50526869 CTGAGAGGGGAGAGGGGAGAGGG + Intronic
1108733539 13:53259061-53259083 CTGGGAGGGGAGAAAGGAGATGG + Intergenic
1109620756 13:64901381-64901403 TAGGGACAGGAGAGGGGAGAAGG + Intergenic
1109863723 13:68233950-68233972 CTGGGAGGGTAGTGGGGAAATGG + Intergenic
1110080267 13:71300741-71300763 ATGGGATAGCAGAGAGAAGAAGG - Intergenic
1110159156 13:72354518-72354540 ATGGCAGAGCAGGGGAGAGAGGG + Intergenic
1110465148 13:75791958-75791980 AAGGAAGAGAAGAGGGGAGAGGG - Intronic
1110632323 13:77723422-77723444 TTGGGAGAGTAGAGGGAAAAAGG + Intronic
1110721948 13:78772023-78772045 GTGTGAGAGCAAAAGGGAGAGGG + Intergenic
1110859034 13:80327624-80327646 CTGAGAGAGTAGTGAGGAGAAGG - Intergenic
1110868067 13:80420176-80420198 ATGGGGGAGAAGTGGGGAGATGG - Intergenic
1111096022 13:83516901-83516923 CTCGGAGAGCAGAGGGGAGCCGG - Intergenic
1111823881 13:93244597-93244619 TTTGGGGAGCAGTGGGGAGAAGG - Intronic
1112157453 13:96833199-96833221 CTGAGAGAGGAGAGGGCAGGAGG - Exonic
1112615194 13:100997381-100997403 CAGGGAGAGCACAGGAGAGGAGG - Intergenic
1112970276 13:105253218-105253240 CTGGGAGAGCAGAGGAGTGAGGG + Intergenic
1113095052 13:106654346-106654368 CTGTCAGAGCAGAGTGGGGAGGG + Intergenic
1113201738 13:107874030-107874052 CAGGGAAAGCAGAGTGGACAGGG + Intergenic
1113343538 13:109450424-109450446 CTGGGAGTGCTGGGGGCAGAAGG - Intergenic
1113457333 13:110458040-110458062 CTGGGAGGGGAGAGGTGAGCAGG - Intronic
1113509250 13:110839186-110839208 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1113555795 13:111232973-111232995 CTGGGAGAACAGGGTGGGGATGG + Intronic
1113784522 13:112995519-112995541 CCAGGAGAGCAGAGGGGAGCTGG + Intronic
1113975512 13:114225263-114225285 GAGGGAGAGAAGAAGGGAGAAGG + Intergenic
1113992015 14:16035396-16035418 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1114269444 14:21092051-21092073 CCGGGAGAGCAGAGGACAGCGGG + Exonic
1114332564 14:21652140-21652162 CTGGGAGAGGGGAAAGGAGAGGG + Intergenic
1114451587 14:22830027-22830049 CTGGGAGAACAGAGCAGAGTTGG - Intronic
1114493069 14:23115224-23115246 CTGGGATCACAGTGGGGAGACGG + Intergenic
1114542353 14:23470747-23470769 CTCGGAAAGCATAGGAGAGATGG - Intronic
1114558678 14:23576633-23576655 GTGGGAGAGCAGAGTGAAGACGG + Intronic
1114726617 14:24944448-24944470 CTGGGAGCACATAGGGGATATGG + Intronic
1114775148 14:25473352-25473374 CTGGCATGCCAGAGGGGAGAGGG + Intergenic
1115165096 14:30439360-30439382 CTGGGGGAGAAGAGAGGAGGGGG - Intergenic
1115724154 14:36194673-36194695 AGGGGAGAGGGGAGGGGAGAGGG + Intergenic
1115771310 14:36666162-36666184 CTGGGAGAGCAAAGGGGCGAAGG + Intronic
1115783153 14:36793499-36793521 TGGGAGGAGCAGAGGGGAGAAGG - Intronic
1115791508 14:36884134-36884156 CTGGGAGAGAAGAGTGGATGGGG - Intronic
1116273823 14:42805403-42805425 CAGGGAGAGGAAAGGGGAAAGGG + Intergenic
1116371559 14:44140529-44140551 ATGAGAGAGGAGAGTGGAGAAGG + Intergenic
1116868085 14:50047547-50047569 CTGTGAAAGCCCAGGGGAGATGG + Intergenic
1117687388 14:58268488-58268510 CTAGGAGGGCGGAGGGGAGGAGG - Intronic
1117936707 14:60914848-60914870 TTGGGAGAGCAGAGTGAACATGG + Intronic
1118010348 14:61604489-61604511 CTGTGGCAGCAGAGGAGAGATGG + Intronic
1118344697 14:64929332-64929354 CTTGAAGAGCAAAGAGGAGATGG - Intronic
1118423362 14:65632987-65633009 GGGGGAGGGGAGAGGGGAGAGGG - Intronic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1118960499 14:70525666-70525688 CTGGGATAGAAGAGGGGAGATGG - Intronic
1119383857 14:74245304-74245326 AGGGGAGAGTGGAGGGGAGAGGG - Intronic
1119437814 14:74609639-74609661 GTGGGGAAGCAGAGGGGAGGTGG - Intronic
1119509225 14:75198069-75198091 ATGGGAGAGAAGAGGAGAAAAGG + Intergenic
1119665194 14:76480367-76480389 CTGGGGCAGCAGAGGGGTGGGGG + Intronic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1119859104 14:77923882-77923904 CAGGGAGAGGGGAGGGGAGCAGG + Intronic
1119886565 14:78148490-78148512 CTGGGAGAGCAGAAGCGAGAAGG + Intergenic
1119924411 14:78479189-78479211 TTGGGAGAGCAGGTGGGGGAAGG - Intronic
1120213542 14:81658171-81658193 CTTGGAAAGTAGAGGGTAGAGGG + Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1121103526 14:91265386-91265408 CTGGGAGGGCAGAAATGAGAGGG + Intergenic
1121119183 14:91365176-91365198 CTGGGAGGGGTGAGGGGTGAGGG - Intronic
1121209830 14:92199898-92199920 CAAGAAGAGCAGAGAGGAGAGGG + Intergenic
1121321695 14:92995266-92995288 GTGGGTGAGCAGAGGGCAGGGGG - Intronic
1121447628 14:93988528-93988550 GTGGGAGAGGAGATGGGAGAGGG + Intergenic
1121456894 14:94044084-94044106 CTGGCAGAGCAGACAGGAGTGGG + Intronic
1121610034 14:95272277-95272299 CTGGAAGGGGAGAGGGGAGGAGG + Intronic
1121649771 14:95549361-95549383 TTGGGAGAGCAGAGGGCAAGGGG + Intergenic
1121658655 14:95618021-95618043 GTGGCAGGACAGAGGGGAGATGG + Intergenic
1121992142 14:98568548-98568570 CTGTCAGAGCTGAGGGGAAAAGG - Intergenic
1122089080 14:99326265-99326287 CAGGCAGAGGAGAGAGGAGAGGG - Intergenic
1122277845 14:100604330-100604352 CTGGGAGAGCAGATTGGGGAAGG + Intergenic
1122316486 14:100828493-100828515 CAGGGAGAGGGGAGGAGAGAAGG - Intergenic
1122326077 14:100881345-100881367 CTGGGTGAGCAGCTGGGTGATGG + Exonic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1122924010 14:104891571-104891593 TTGGGGGAGCATAGGGAAGAAGG + Intronic
1122987487 14:105219233-105219255 CTGGGCGAGCACAGGGAAGTGGG + Intronic
1123096502 14:105769419-105769441 GTGGGAGAGCAGCGGGCAGCCGG - Intergenic
1123113215 14:105882524-105882546 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123115568 14:105892675-105892697 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123402551 15:20002960-20002982 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123511889 15:21009614-21009636 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123978711 15:25578718-25578740 GTGGAAGGGCAGAGGGCAGAGGG - Intergenic
1124152716 15:27196301-27196323 CTGGGAGGGCTGAGGGGAGCAGG - Intronic
1124630148 15:31331553-31331575 CTGGCAGAGCAGAGGGCATCTGG + Intronic
1124867188 15:33503993-33504015 CTGGGATAAGAGAGGGGAGTAGG - Intronic
1125101541 15:35918727-35918749 TGGGGAGGGCAGTGGGGAGACGG + Intergenic
1125397772 15:39269130-39269152 CTGGGAGAGCACATGGGTGCAGG + Intergenic
1125498673 15:40222696-40222718 TGAGGAGAGCAGAGAGGAGAGGG - Intergenic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1125663296 15:41411380-41411402 TTGGGAGAGAAGAGGGATGAGGG + Intronic
1125697676 15:41652368-41652390 CGGGGAAAGGAGAGGGGAGAGGG - Intronic
1125921757 15:43529239-43529261 CTGGGAGAGTAGAGAGGCTACGG + Exonic
1126023618 15:44426009-44426031 ATGGGAGGGCAGGGGGAAGATGG - Intergenic
1126367485 15:47910802-47910824 ATGAGAGAGTAGAGGGGAGGAGG - Intergenic
1126466208 15:48963464-48963486 CTGTGAGAGCCGAAGGGAGCAGG - Intergenic
1126693027 15:51302611-51302633 CTGTGAGGACAGTGGGGAGAGGG - Intronic
1127044160 15:55008540-55008562 AGGGGAGAGCAGAGGAGGGAAGG - Intergenic
1127088944 15:55447799-55447821 GGGAGAGGGCAGAGGGGAGAGGG + Intronic
1127088952 15:55447820-55447842 GGGAGAGGGCAGAGGGGAGAGGG + Intronic
1127088960 15:55447841-55447863 GGGAGAGGGCAGAGGGGAGAGGG + Intronic
1127167166 15:56256933-56256955 ATGGGAGAGCAGAGGGTGGGAGG - Intronic
1127365370 15:58284428-58284450 CTGGGTGAGCAAAGGTGAGTTGG + Intronic
1127395665 15:58542171-58542193 GTGGATGAGGAGAGGGGAGAAGG - Intronic
1127473353 15:59309980-59310002 CTGTGAGAACAGAGAGGAAAGGG - Intronic
1127657780 15:61071625-61071647 AGGGGAGAGGGGAGGGGAGAGGG + Intronic
1127784392 15:62343117-62343139 CTGGGGGAGCACAAGGGAGAAGG + Intergenic
1128056252 15:64702384-64702406 CTGGGAGAGGGGTGTGGAGAGGG + Intronic
1128151842 15:65368214-65368236 TCTGGAGAGAAGAGGGGAGAGGG + Intronic
1128478918 15:68020583-68020605 CAGGCAGAGCAGAAGGCAGAAGG - Intergenic
1128528180 15:68426457-68426479 CTGGGTGGGGAGAGGGGAGAGGG + Intronic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1129000019 15:72325026-72325048 GAGAGAGAGGAGAGGGGAGATGG - Intronic
1129034866 15:72642804-72642826 ATGGAAGTGGAGAGGGGAGACGG - Intergenic
1129114778 15:73359208-73359230 CTGGGGGAGCAGTGGGTGGAGGG + Intronic
1129215016 15:74094412-74094434 ATGGAAGTGGAGAGGGGAGACGG + Intergenic
1129450786 15:75650055-75650077 CTGGGAGAGCACAGGGTGGCTGG - Exonic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1129609865 15:77044583-77044605 CTGGCAGAGCACACGGGAGGAGG + Exonic
1129930253 15:79404624-79404646 TTGGGAGATCAGAGGTCAGAAGG - Intronic
1130006839 15:80107822-80107844 AGAGGAGAGGAGAGGGGAGAGGG + Intronic
1130006859 15:80107867-80107889 TTGGGAGGGCAGCGGGGAGGGGG + Intronic
1130124191 15:81079151-81079173 GGGGGAGGGGAGAGGGGAGAGGG + Intronic
1130459981 15:84153661-84153683 AGAGGAGAGGAGAGGGGAGAGGG + Intergenic
1130624912 15:85504274-85504296 CTGGGAGAGGAGAGAGGAGAGGG + Intronic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1131603282 15:93872201-93872223 GTGAGAGAGCAGAGAGAAGAGGG - Intergenic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1132302206 15:100782932-100782954 CTGGTACAGGAGAGGGGAGGAGG + Intergenic
1132338871 15:101065663-101065685 CTCTGAGGGCAGAGGGGAGGAGG + Exonic
1132359517 15:101201058-101201080 CTGGGAGGGCAGTGGGCAGTGGG - Intronic
1132400890 15:101504542-101504564 CAGGAAGAGCAAAGGCGAGAAGG + Intronic
1132592127 16:730658-730680 ATGGGAGAGCAGACGGGACAGGG + Intronic
1132607825 16:800857-800879 CTGGGTGAGCCCAGGGGAGGGGG - Intergenic
1132649465 16:1014015-1014037 CTGGGATGGCTGAGAGGAGAGGG + Intergenic
1132656722 16:1044561-1044583 CTGGGAGCCCAGGGAGGAGAGGG + Intergenic
1132674693 16:1116892-1116914 CCGGGGGAGCAGAGGGGGGCGGG - Intergenic
1132716452 16:1292562-1292584 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1132771740 16:1567399-1567421 TGGGGACAGCAGAGGGCAGAGGG - Intronic
1132771910 16:1568161-1568183 CTGGGAGGACAGAGGTGAGGAGG + Intronic
1132860819 16:2070933-2070955 CTGAGAGGGCAGAGCTGAGACGG + Intronic
1132923333 16:2411918-2411940 GTGGGGGAGCTGAGGGCAGAGGG - Intergenic
1132956453 16:2596853-2596875 CAGGCAGAGCAGAGGGGCCAGGG + Intronic
1132997607 16:2831306-2831328 CTGGGAGAGCACCAGGGTGAGGG + Intronic
1133086562 16:3368657-3368679 CTGGGAGAGAAAGGAGGAGAAGG + Intronic
1133119834 16:3599216-3599238 CTGAGATGGCAGAGGGCAGAGGG - Intronic
1133278417 16:4651678-4651700 CTGGGAGAGCAGGTTGGGGATGG + Intronic
1133303732 16:4797729-4797751 CTGGCAGAGCTGCAGGGAGACGG + Exonic
1133647247 16:7775856-7775878 AGGGGAGAGCAGGGGGAAGAGGG + Intergenic
1133868155 16:9663142-9663164 GTGTGAGAGCACAGGAGAGAAGG + Intergenic
1133996223 16:10750649-10750671 CTGGGACTGCAGAGCTGAGAGGG + Intronic
1134523215 16:14927844-14927866 GGGGGAGGGGAGAGGGGAGAGGG - Intronic
1134592068 16:15462592-15462614 CTGGGAGAGGAGGCCGGAGAGGG + Intronic
1134909293 16:18009573-18009595 CTGTGAGAGCTGATAGGAGATGG + Intergenic
1135077902 16:19410190-19410212 CTGGGAAAGGAGGGGAGAGAAGG + Intergenic
1135294764 16:21269749-21269771 GTGGGAGAGAAGAGGGAAGGGGG - Intronic
1135840773 16:25874080-25874102 CTGGTAAAGCAGAGAGGACAGGG - Intronic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136236077 16:28914480-28914502 CTGGAGGAGCTGAGCGGAGATGG - Exonic
1136294034 16:29291661-29291683 CTGGAGGAGCAGACGGGAGTGGG + Intergenic
1136474669 16:30505294-30505316 CTGGGAGGTAAGAGGGGAGAAGG + Exonic
1136504685 16:30695413-30695435 GTGGGAGAGAGGAGGGAAGATGG - Intergenic
1136519742 16:30787550-30787572 CTGGCAGAGCAGACCTGAGAGGG + Intergenic
1136548060 16:30966359-30966381 GTGGGAGAGCAAGGAGGAGAAGG + Exonic
1136849755 16:33603302-33603324 AGGGGAGGGGAGAGGGGAGAGGG - Intergenic
1137027024 16:35486572-35486594 CAGGGACAGCAGGGAGGAGAGGG - Intergenic
1137509880 16:49089930-49089952 GAGGAAGAGCAGAGAGGAGATGG - Intergenic
1138235645 16:55380179-55380201 CAGGGAGAGCAGAGGGGGAAGGG - Intergenic
1138358544 16:56406017-56406039 GTGGAAGGGGAGAGGGGAGAGGG + Intronic
1138451019 16:57093281-57093303 CTGGGAGCGCAGAGGGGGAGTGG + Intronic
1138515979 16:57535867-57535889 CTGGGAGAGCGGGGGTGGGAAGG + Intronic
1138583854 16:57958175-57958197 GTGGGGGAGCAGAGAGGATATGG - Intronic
1138891715 16:61150673-61150695 CAAGGAGAGCAGAGAGGAGCAGG - Intergenic
1139114490 16:63933115-63933137 CTAGGAGGGGAGAGGGGAAAGGG + Intergenic
1139282606 16:65783654-65783676 CTGGGATATCAGAGATGAGATGG + Intergenic
1139339655 16:66259676-66259698 CTGTGCCAGCAGAGGCGAGAGGG + Intergenic
1139510792 16:67427390-67427412 CTGGGAGGGGAGAGTGGTGATGG + Intergenic
1139589252 16:67924324-67924346 CTTGGGGAGCAGCGGGGAGAGGG + Intronic
1139612187 16:68067167-68067189 ATGGGAGGGGAGGGGGGAGAGGG - Intronic
1139612230 16:68067267-68067289 AGGGGAGAGGAGAGGGGAGGGGG - Intronic
1139967635 16:70754552-70754574 CAGGGACAGCCGCGGGGAGAGGG + Intronic
1139970951 16:70774713-70774735 GAGGGAGGGGAGAGGGGAGAGGG - Intronic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140673500 16:77303145-77303167 CTGGTGGAGATGAGGGGAGATGG - Intronic
1141019958 16:80485679-80485701 CTGGGAGAGCAGTGGCTGGAGGG + Intergenic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1141497715 16:84421301-84421323 CTGGGAAGGAAGTGGGGAGACGG + Intronic
1141557197 16:84844022-84844044 CTGGGTGTGCAGAGGGCAGGAGG + Intronic
1141575859 16:84963282-84963304 CTGGGGGAGGCGAGGGGAGGAGG - Intergenic
1141585013 16:85027962-85027984 CTGGGAGCGCCGTGGGGCGAGGG + Intronic
1141602233 16:85133824-85133846 CCGGGAGTGCAGACGGGAGGTGG + Intergenic
1142008313 16:87700787-87700809 GTTGGAGGGCAGAGGGGAGGAGG + Intronic
1142104376 16:88294481-88294503 CTGGGAGCCCAGAGGGCAGGAGG - Intergenic
1142108326 16:88318147-88318169 CTGGGAGAGAAGGGCTGAGAGGG - Intergenic
1142133482 16:88441382-88441404 GTGGGAGAGAGGAGGGGACAAGG - Intergenic
1142225775 16:88877010-88877032 CTGGGGGAGCCGGGGCGAGAAGG + Exonic
1142261203 16:89043245-89043267 CTGAGCGAGCAGAGCTGAGATGG - Intergenic
1142313090 16:89325436-89325458 GAGAGAGAGGAGAGGGGAGAGGG - Intronic
1142369134 16:89668503-89668525 CTGGGAGAGCAGGATGGAGCTGG - Intronic
1142431487 16:90030722-90030744 CTGGGAGAGCTGAGGTGGGAGGG - Intronic
1203111345 16_KI270728v1_random:1451616-1451638 AGGGGAGGGGAGAGGGGAGAGGG - Intergenic
1142480474 17:215613-215635 CGGGGGCAGGAGAGGGGAGAAGG + Intronic
1142668992 17:1478820-1478842 CTGGGAGTGCAGAGTGGTGGCGG - Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143026131 17:3942968-3942990 CTTGGAGAAAAGAGGGGAGAAGG - Intronic
1143034300 17:3985741-3985763 CTGGGGGAGCAGGGAGCAGAGGG + Intergenic
1143065588 17:4244688-4244710 CTGAGGAAGCAAAGGGGAGATGG - Intronic
1143389927 17:6554374-6554396 CTGGGAGAGCTGAGCTGAGAAGG + Intronic
1143520614 17:7442213-7442235 CTGGGAGTACAGTGGAGAGAAGG + Intronic
1143550885 17:7629883-7629905 CTAGAGGAGGAGAGGGGAGATGG + Intronic
1143685003 17:8506758-8506780 CTGTGAGAGCCGAAGGGAGCTGG + Intronic
1143900388 17:10170137-10170159 AGGGGGGAGCAGAGGGTAGAAGG - Intronic
1143916196 17:10295180-10295202 CTAGAAGAGCAGAGGGAAGGAGG - Intergenic
1144025176 17:11271086-11271108 CAGGGAGAGAAGAGGCGGGAAGG + Intronic
1144081286 17:11766599-11766621 CTGTGAGAGCCCAGGGGACATGG + Intronic
1144486563 17:15670421-15670443 CTGGGAGAGCAATGGGCATAGGG - Intronic
1144701654 17:17344517-17344539 CTGGGTGTGAAGAGGGGACAGGG + Intronic
1144726725 17:17506015-17506037 GCGGGAGAGGGGAGGGGAGAGGG + Intronic
1144746726 17:17620905-17620927 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1144755818 17:17680198-17680220 TTGGTAGGGCAGAGGGGAGCTGG - Intergenic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144879752 17:18425240-18425262 CTAGAAGACCAGAGGGGAGGAGG + Intergenic
1144914457 17:18711869-18711891 CTGGGAGAGCAATGGGCATAGGG + Intronic
1145014539 17:19387671-19387693 CTGGGGGAGCAGAAGGCTGAGGG + Intergenic
1145187347 17:20806386-20806408 CTCTGAGAGCAGAGTGGAGATGG + Intergenic
1145750957 17:27354475-27354497 CAGGGAAGGCAGAGGGGACAGGG - Intergenic
1145813857 17:27781542-27781564 CTGGGAGAGCAGGGGGAAGATGG - Intronic
1145928715 17:28668169-28668191 CTAGAAGGGCAGTGGGGAGATGG - Intronic
1146200136 17:30850297-30850319 GTGGGAGAGGGGAGGGGAGAGGG - Intronic
1147167972 17:38603452-38603474 CGGGGAGTGCTGAGTGGAGAGGG - Intronic
1147370901 17:39992361-39992383 GTGTGAGGGCAGAGGGCAGAGGG - Intronic
1147555195 17:41474540-41474562 CTGGGAGTGCAGAGGGCTCAGGG - Intergenic
1147556929 17:41485632-41485654 CAGGGAGAGCAGGGAGGTGAAGG - Intergenic
1147668644 17:42164130-42164152 CTGGGAGAGGCGAGGGGATCGGG + Exonic
1147754859 17:42761402-42761424 CCCGGAGGGGAGAGGGGAGAGGG + Intronic
1147805102 17:43125622-43125644 CTGGAAGAGTAGAGGCTAGAGGG - Intergenic
1147811105 17:43170439-43170461 CTGGAAGCGTAGAGGCGAGAGGG - Intergenic
1147845757 17:43402878-43402900 CTGCCAGAGTAGTGGGGAGAGGG + Intergenic
1147862324 17:43530823-43530845 GTGGGAGTGCAGTGGGGGGAGGG - Intronic
1147894401 17:43741114-43741136 CTTGGGGAGCACAGAGGAGAGGG + Intergenic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148259981 17:46173211-46173233 TTGAGAGAGAAGAGGGCAGAAGG - Intronic
1148463679 17:47851838-47851860 CTGGGAGAGGGGAGGAGAGGAGG - Intronic
1148716607 17:49720285-49720307 GGAGGAGAACAGAGGGGAGAGGG + Intronic
1148776620 17:50099293-50099315 CTGGGAGAGCTGAGGGATGCAGG + Intronic
1148864996 17:50623783-50623805 CTGGGAGGGCACGGGGGTGAGGG + Intronic
1149572692 17:57684902-57684924 ATGGAAGAGCAGACGGGAGAGGG + Intergenic
1149633727 17:58149065-58149087 CTAGGAGAGACGAGGGGAGAAGG - Intergenic
1149919712 17:60645754-60645776 CTGGAAGGGCAGTGGTGAGAAGG + Intronic
1150008312 17:61483248-61483270 CTGGGAGCTCTGAGCGGAGAGGG - Exonic
1150135497 17:62692908-62692930 GTGGGAGAGAAGGGGCGAGAGGG - Exonic
1150200394 17:63350296-63350318 GGGGGAAAGCAGAGGGAAGAGGG - Intronic
1150321382 17:64217256-64217278 CTGGGAGGACAGAGAGAAGAGGG - Intronic
1150949177 17:69783205-69783227 CTGGGAGAGATGTGGGGAAAGGG + Intergenic
1151215662 17:72575011-72575033 CTGGGGGAGGAGATTGGAGAGGG - Intergenic
1151227261 17:72656482-72656504 GTGGGACAGGAGAGGAGAGAGGG + Intronic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151796772 17:76351859-76351881 GAGGGAGAGCAGAGGGGAGCAGG - Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152214221 17:79023226-79023248 CTCGGAGAGAACAGGGCAGAGGG + Intronic
1152225163 17:79089511-79089533 CCGGAACAGCAGAGGGGACAGGG + Intronic
1152455674 17:80414868-80414890 CGGGGACAGCAGAGGCGGGACGG + Intergenic
1152924961 17:83082943-83082965 ATGTGAGAGGAGAGGGGAGCAGG + Intronic
1152940879 17:83172458-83172480 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152940891 17:83172496-83172518 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152940970 17:83172796-83172818 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152940982 17:83172834-83172856 CTGGGTCAGCAGTGGGGTGAGGG + Intergenic
1152941005 17:83172908-83172930 CTGGGTGAGCACTGGGGTGAGGG + Intergenic
1152941026 17:83172984-83173006 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941044 17:83173060-83173082 CTGGGTGAGCAGTGGGGTGAAGG + Intergenic
1152941077 17:83173173-83173195 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941089 17:83173211-83173233 CTGGGTCAGCAGTGGGGTGAGGG + Intergenic
1152941131 17:83173363-83173385 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941143 17:83173401-83173423 CTGGGTCAGCAGTGGGGTGAGGG + Intergenic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1153805752 18:8706811-8706833 CGTGGAGAGCAGGAGGGAGAAGG - Intronic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1154157984 18:11959003-11959025 GGGAGAGAGGAGAGGGGAGAGGG - Intergenic
1154157991 18:11959024-11959046 GAGAGAGAGGAGAGGGGAGAGGG - Intergenic
1154387507 18:13908362-13908384 CAGGAAGGGTAGAGGGGAGAGGG + Intronic
1155387346 18:25292922-25292944 TGAGGAGAGCAGAGTGGAGATGG - Intronic
1156013218 18:32517759-32517781 CTGGGAGAGGGGAAAGGAGAAGG - Intergenic
1156310699 18:35919192-35919214 ATGTTAGAGGAGAGGGGAGAGGG + Intergenic
1156456396 18:37297046-37297068 CAGGGAGAGAAGAGGGGAGCAGG + Intronic
1156461952 18:37326210-37326232 AAGGGAGAGCAGAGGGGTCAGGG + Intronic
1156485330 18:37462068-37462090 GTGGCAGAGCAGAGGAGAGTAGG + Intronic
1156487880 18:37478106-37478128 CAGGGAGAGGAGAGGAGAGGGGG - Intronic
1156658265 18:39313457-39313479 CAGCAAGAGGAGAGGGGAGAAGG - Intergenic
1157075958 18:44467804-44467826 AGGGCAGAGCAGAGGGGAGGAGG - Intergenic
1157280084 18:46341233-46341255 TTGGGAGCTCTGAGGGGAGAGGG + Intronic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157399271 18:47373508-47373530 CTGGGAGAGCAGGTGAGAGGTGG - Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1158219956 18:55140304-55140326 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1158323070 18:56284649-56284671 TGGGGGGATCAGAGGGGAGAAGG - Intergenic
1158602464 18:58866326-58866348 GTTGGAGAGGAGAGGAGAGAAGG + Intronic
1158794508 18:60827019-60827041 TTGGGGTAGCAGAGTGGAGAGGG + Intergenic
1159054184 18:63448651-63448673 GTGGGAGAGAAGAGGGGAGTGGG + Intergenic
1160579390 18:79875032-79875054 CTGGGAGATCACAGGGCAGAAGG - Intronic
1160685120 19:431019-431041 CTGGGAGAGCAGAGCGGGGAAGG - Intronic
1160746438 19:713321-713343 TTGGGAGAGGAGTGTGGAGAGGG + Intronic
1160930917 19:1568975-1568997 CTAGGAGAGACTAGGGGAGAGGG - Intergenic
1160975472 19:1790398-1790420 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161093826 19:2377446-2377468 AGGGGAGAGGGGAGGGGAGAAGG - Intergenic
1161093834 19:2377465-2377487 GGGAGAGAGGAGAGGGGAGAGGG - Intergenic
1161093863 19:2377529-2377551 AGGGGAGGGGAGAGGGGAGAGGG - Intergenic
1161093866 19:2377536-2377558 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1161093912 19:2377637-2377659 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1161222895 19:3126176-3126198 CTGGGAGGACAGACGGGTGAGGG + Intergenic
1161235165 19:3194021-3194043 CTGGGGGAGCAGGGCTGAGAAGG + Intronic
1161431214 19:4233432-4233454 CTGGTAGAGGAGGGGGAAGAAGG - Intronic
1161474077 19:4474698-4474720 CTAGGAGAGCAGGCTGGAGAAGG - Intronic
1161562161 19:4979453-4979475 CTGGGAGATCTGAGAGGGGATGG + Intronic
1161592185 19:5133860-5133882 CTAGAAGAACAGAGGGGAGAGGG - Intronic
1161777372 19:6270937-6270959 GTGGGAGTACGGAGGGGAGAAGG - Intronic
1161951203 19:7469118-7469140 CTGGGAGAGCTCAGGTGAGCCGG + Exonic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1161970669 19:7578090-7578112 TTGGGAGAGGAGAGAGGAAAGGG + Intergenic
1161991586 19:7687310-7687332 CTGGTAGAGGAGTGTGGAGAGGG + Exonic
1162111937 19:8404113-8404135 AGGGGAGGGGAGAGGGGAGAGGG - Exonic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1162496334 19:11025197-11025219 CTGGCACAGCAGAGGGCAGATGG - Intronic
1162760631 19:12886298-12886320 CTGGGGGGGGAGCGGGGAGAGGG - Intronic
1162774922 19:12973671-12973693 CTTGGAGAAATGAGGGGAGATGG + Exonic
1162936015 19:13981978-13982000 CTGGGAGTGAAGAGGGAAGCAGG + Intronic
1163176004 19:15564373-15564395 CTGGGACATCAGAGGAGTGAGGG + Intergenic
1163548584 19:17952839-17952861 CCGGGAGAGGGGAGGGGGGAAGG - Intronic
1163585832 19:18162944-18162966 CTGGGGGAGGAGAGGGGTGTCGG - Intronic
1163644802 19:18483134-18483156 TTGGGAGGGGAGAGGGGAGTTGG - Intronic
1163646225 19:18490753-18490775 CTGGGAGATTTGAGGGGAGGAGG - Intronic
1163703788 19:18800674-18800696 CTTGGAGAGCTGAGAGGTGAGGG - Intergenic
1163829156 19:19539654-19539676 GTGGGTGAGGAGTGGGGAGAAGG - Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1163945686 19:20531254-20531276 AGGGGAGAGGGGAGGGGAGAGGG + Intergenic
1164441192 19:28282056-28282078 GGGGAAGAGGAGAGGGGAGAAGG - Intergenic
1164629801 19:29754768-29754790 CTGTGAGCACAGTGGGGAGAGGG - Intergenic
1164822904 19:31264055-31264077 ATAGGAGTGCAGTGGGGAGATGG + Intergenic
1165100537 19:33436115-33436137 CGGGGAGAAAAGAAGGGAGAAGG + Intronic
1165245271 19:34494947-34494969 CTGGGGGAGCAGATGAGAGATGG + Intronic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1166109546 19:40613825-40613847 CTAGGAGAGCCGAGGGGCGGTGG + Intronic
1166345033 19:42160200-42160222 CTGGGTGGGCAGAGTGGAGAAGG + Intronic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166665966 19:44680621-44680643 CTGGGAGACCAGTGAGGAGCTGG - Intronic
1166700661 19:44879693-44879715 TTGGGAGAGCAGAGGTGACGCGG - Intronic
1166830802 19:45638679-45638701 CTGGAAGAGGAGAGGGAATAGGG - Intronic
1166830938 19:45639309-45639331 CCGGGAGCGCGGAGAGGAGATGG + Intronic
1166835623 19:45666031-45666053 GGGGGAGGGGAGAGGGGAGAGGG + Intergenic
1166936917 19:46339637-46339659 CTGGGGGAGGAGAAGGCAGATGG - Exonic
1166994475 19:46713788-46713810 CTGGGGGAGGAGAGGGTAGGGGG - Intronic
1167007171 19:46783676-46783698 CTGGGAAGGCTGAGGTGAGAAGG + Intronic
1167171920 19:47839297-47839319 CTGGGGGATAAGAGCGGAGATGG - Intronic
1167220879 19:48197208-48197230 TAGGGAGTGCAGCGGGGAGAGGG + Exonic
1167455286 19:49594568-49594590 CTGGGAGAGGAGAGAGGAGGCGG - Exonic
1167603455 19:50467511-50467533 GTGGGGCAGCAGAGGGCAGAGGG - Intronic
1167608536 19:50494692-50494714 CTGGCAGGGCAGAGAGGAGGGGG + Intergenic
1167651776 19:50734890-50734912 GAGGGAGAGAAGAGGGCAGAGGG - Intergenic
1167698185 19:51026985-51027007 CAGAGAGAGAAGAGTGGAGATGG - Intronic
1167767959 19:51496834-51496856 CTGGGAGAAAGCAGGGGAGAAGG + Intronic
1167792796 19:51691549-51691571 CGGGGAGAGGAGAGAGGCGATGG + Intergenic
1167937818 19:52922263-52922285 CAGGGAGAGCTCAGGAGAGATGG - Intergenic
1168283991 19:55321411-55321433 CTGGGTGAGCTTAGGGAAGAAGG + Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
1168326623 19:55541865-55541887 CTGGGAGACCAGCTGGGAGTTGG - Intronic
1168689791 19:58369362-58369384 CTGGAAGAGCAGAGAAGAAATGG + Intronic
1168692142 19:58383613-58383635 CTGGAAGAACAGAGGAGAAATGG + Intergenic
924998729 2:386869-386891 GGGAGAGGGCAGAGGGGAGAGGG - Intergenic
924998743 2:386918-386940 CGCAGAGGGCAGAGGGGAGAGGG - Intergenic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
925128696 2:1479220-1479242 GGGGTTGAGCAGAGGGGAGAAGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925310229 2:2876552-2876574 CAGGGAGAGCGGCTGGGAGAAGG - Intergenic
925404714 2:3598637-3598659 CCGCGTGAGCACAGGGGAGAAGG + Intronic
925631560 2:5899062-5899084 CTAGGTTAGCAGATGGGAGAAGG - Intergenic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
926037008 2:9643732-9643754 CTGAGAGAGGAGAGAGGAGAGGG - Intergenic
926238686 2:11068867-11068889 CAGGGAAAGCTGAGGGGAGCGGG + Intergenic
926329681 2:11814111-11814133 CTGGCAGAGCTGATGGGAGCAGG + Intronic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
926443193 2:12911463-12911485 AGGAGAGAGGAGAGGGGAGAAGG + Intergenic
926645993 2:15290075-15290097 GGGAGAGAGTAGAGGGGAGAGGG + Intronic
926646000 2:15290096-15290118 GGGAGAGAGGAGAGGGGAGAGGG + Intronic
926767191 2:16331902-16331924 CTGGGGTAGCAGAGTGGAAATGG - Intergenic
926805574 2:16707595-16707617 CTGGGAGAGCAGGGGAGTAAGGG - Intergenic
927088127 2:19690395-19690417 AGGGGAGAGGAGAGAGGAGAGGG + Intergenic
927181631 2:20450621-20450643 CTCCAGGAGCAGAGGGGAGAGGG + Intergenic
927200837 2:20577242-20577264 CTGGGAGCTGAGTGGGGAGAGGG + Intronic
927265760 2:21148961-21148983 CTGGCAGGGCTTAGGGGAGAGGG - Intergenic
927514754 2:23665675-23665697 GGTGGAGAGCAGAGGGGAGCAGG + Intronic
927599725 2:24430397-24430419 GAGAGAGAGGAGAGGGGAGAAGG - Intergenic
927705348 2:25293283-25293305 CTGGGAGAGGGGAGGGGGCAGGG - Intronic
927711798 2:25330750-25330772 CCGGGAGAGCAGAGGGCATGGGG - Intronic
928089946 2:28367892-28367914 CAGGGAGAGCAGGGGTGAGGGGG + Intergenic
928270364 2:29849805-29849827 AGGGGAGAGGAGAGGGGAGGAGG + Intronic
928403323 2:30994938-30994960 CTATGAGAGCAGAGGAGTGAGGG + Intronic
928559170 2:32461156-32461178 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
928559176 2:32461168-32461190 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929112332 2:38415399-38415421 CTGGAAGAGCAGAAGAGTGATGG - Intergenic
929456465 2:42069555-42069577 CCAGGAGGGCAGAAGGGAGAAGG - Intergenic
929788880 2:45009835-45009857 TGGGGAGAGAAGAGGAGAGAAGG + Intergenic
929824340 2:45298687-45298709 CTGTGAGAGCAGCTGTGAGAGGG + Intergenic
930699095 2:54441201-54441223 CTAGGAGGGAAGAAGGGAGAAGG - Intergenic
930948342 2:57105292-57105314 CTGTGAGAGCAGAGGCCACAGGG + Intergenic
931533536 2:63245455-63245477 CTTGGAGAGCAGAAGGGTGTTGG + Intronic
931763796 2:65437198-65437220 GTGGGGGATGAGAGGGGAGAGGG - Intergenic
931812085 2:65863933-65863955 GTGGGAGGGCAGAGGGCAGTGGG - Intergenic
932289680 2:70566321-70566343 CTGGAAGAGCAGGGGAGATATGG - Intergenic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932400999 2:71481270-71481292 CAGGGAGGGCTGTGGGGAGAAGG - Intronic
932711407 2:74067102-74067124 AAGGGAGAGCAGGGGGGAGTGGG - Intronic
933131845 2:78681921-78681943 CTGGGTGGGGAGAGGGGAGTGGG - Intergenic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
933727594 2:85435554-85435576 CTGGCCGAGCAGTGGGGAGCAGG + Intronic
933973276 2:87487510-87487532 CTGGGAGAGCTGCAAGGAGATGG + Intergenic
934066613 2:88347634-88347656 CGGGGAGAGAAGAGGTGAGATGG - Intergenic
934692661 2:96373578-96373600 CTAGGAGAGGGGAGGGCAGAGGG + Exonic
934998710 2:98989711-98989733 GGGAGAGAGGAGAGGGGAGAGGG + Intergenic
935009476 2:99119314-99119336 TTTTGAGAGCAGATGGGAGAAGG - Intronic
935011175 2:99137577-99137599 GTGGGAGGGGAGAAGGGAGAGGG - Intronic
935019745 2:99218310-99218332 CTGTGACAGCAGAGTGGTGAAGG - Intronic
935061805 2:99615214-99615236 CTGGGAGTCCAGATGGTAGAGGG + Intronic
935124269 2:100209185-100209207 CTGGAAGGGTAGAGGGTAGAAGG - Intergenic
935263068 2:101371409-101371431 CAGGGAGAGCAGAGGCCAAAGGG + Intronic
936064724 2:109322078-109322100 AAGGGAGAGAAGCGGGGAGAGGG + Intronic
936267728 2:111023215-111023237 CAGGGAGATGAGAGGGGAGCGGG + Intronic
936320445 2:111462701-111462723 CTGGGAGAGCTGCAAGGAGATGG - Intergenic
936805067 2:116321406-116321428 CTGGGAAAGGAGGGTGGAGAAGG + Intergenic
936878288 2:117218862-117218884 CTGGAAGAGCAGAGGAGGGTGGG + Intergenic
937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG + Intronic
937150511 2:119682828-119682850 CAAGGAGAGCAGAGGGGTGGAGG + Intronic
937307477 2:120881368-120881390 CAGGGAGGACAGTGGGGAGAGGG + Intronic
937694054 2:124788128-124788150 CTGGGAGAACCCAGGGGAGGTGG - Intronic
937819283 2:126289749-126289771 CTGGAAGAGATGAGGGGAAAAGG + Intergenic
938019318 2:127893146-127893168 CCGGGAGAGCACTGGGGACAGGG + Intergenic
938811257 2:134855052-134855074 AAGGGAGAGGAGAGGGGTGATGG - Intronic
938851277 2:135263098-135263120 CTGGGAGAGAAGAATGGATATGG - Intronic
938934394 2:136116362-136116384 CAGGGAGGGAAGAGGGGAGAAGG + Intronic
939606603 2:144262633-144262655 GAGGGAGAGGGGAGGGGAGATGG + Intronic
939874674 2:147564037-147564059 TTGGGGGAGGAGGGGGGAGAAGG + Intergenic
939993091 2:148894891-148894913 TGGGGAGAGGAGAGGGGATAAGG - Intronic
940002909 2:148984689-148984711 CTGGGAAAGCAAAGGGGACTGGG + Intronic
940109797 2:150138940-150138962 CTGGGAAAGCCTAGGGGAGGAGG + Intergenic
940336684 2:152536134-152536156 GTGGGCTAGAAGAGGGGAGAGGG - Intronic
940975488 2:159938723-159938745 CTGGTAGTGTTGAGGGGAGAAGG - Exonic
941724341 2:168844933-168844955 CTGGGAGAGCAAAGGCTATATGG + Intronic
942251844 2:174053901-174053923 CGGGGAAGGAAGAGGGGAGAGGG + Intergenic
942949076 2:181702489-181702511 GTGGGAGAAGTGAGGGGAGAGGG - Intergenic
943743203 2:191433648-191433670 TGGGGAGAGTAGAGGGGAGTGGG - Intergenic
944257790 2:197641401-197641423 CTGGGAGAGAAGAAGAGGGAGGG + Intronic
944508333 2:200438774-200438796 CTGGAATAGCAGGGGGGAAAAGG + Intronic
944661390 2:201924571-201924593 ATGGGGGAGGAGAGGGGAGCTGG - Intergenic
944837476 2:203594063-203594085 CTGGGAGTGCTGAAGGGACATGG - Intergenic
945395244 2:209307853-209307875 CTGGGAGTGCAGAAGGGGGCAGG + Intergenic
945502065 2:210588677-210588699 CTGAGAGAGGAGTGAGGAGAAGG - Intronic
945920540 2:215750598-215750620 CTGGTAGAGGGGAAGGGAGAGGG + Intergenic
946191794 2:218011435-218011457 CCGGGAGAGAAGAGGGGCGGAGG + Intergenic
946399375 2:219460669-219460691 GAGGGGGAGGAGAGGGGAGAGGG - Intronic
947051516 2:226049035-226049057 CTAGGAGAGAAGTAGGGAGAGGG + Intergenic
947428887 2:230008234-230008256 CTGAGAGAAGAGAAGGGAGAAGG - Intronic
947551768 2:231051451-231051473 ATGGGAGGTCAGAGGGAAGAAGG + Intergenic
947636066 2:231681250-231681272 CCGGGAAGGCAGAGGGGAGCGGG - Intergenic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
947843148 2:233221759-233221781 CAGGCAGAGGAGATGGGAGAAGG - Intronic
948045486 2:234940556-234940578 CTGGGAGGGCAGAGAGTGGAGGG - Intergenic
948079136 2:235191348-235191370 CCAGGAGAGGAGAGGAGAGAAGG - Intergenic
948121743 2:235535953-235535975 CTGGGAGAGCAGGAAGCAGATGG - Intronic
948459248 2:238121190-238121212 CTTGGCTAGCAGAGGGGAGGGGG - Intronic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
948716906 2:239871023-239871045 CTGAAGGAGCGGAGGGGAGAGGG + Intergenic
948742426 2:240056668-240056690 CAGGAAGAGCAGAGAGGAGGAGG + Intergenic
948903146 2:240966141-240966163 CTGGGGCAGCAGAGAGGAAAGGG + Intronic
948920430 2:241063745-241063767 CTGGAAGATCAGAGAGGAGGTGG + Intronic
1168806887 20:676767-676789 CTGGGAAGGGAGAGGGGGGAAGG + Intergenic
1169259710 20:4127441-4127463 ATAAGGGAGCAGAGGGGAGATGG + Intronic
1169634135 20:7668326-7668348 TAGGCAGAGCAGAAGGGAGACGG + Intergenic
1169674408 20:8137281-8137303 ATGAGAGAGCAGAGGGGAAAAGG + Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170822667 20:19767521-19767543 CTGAGAGACCAGAGGGCAGGAGG + Intergenic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1170949456 20:20923723-20923745 CTGGGACAGCTGAGAGGAGCAGG + Intergenic
1170984640 20:21246076-21246098 TTATGAGAGCAGAGAGGAGAAGG - Intronic
1171414321 20:24967385-24967407 CTGGGTGAGGAGGGGTGAGAGGG - Intronic
1171544887 20:25992296-25992318 CAGGGAGAGACGCGGGGAGAGGG - Intergenic
1171812560 20:29757023-29757045 CTGGGGGAGAAGAGGGGACAAGG + Intergenic
1171906681 20:30905264-30905286 CTGGGGGAGAAGAGGGGACAAGG - Intergenic
1172100073 20:32480022-32480044 ACGGGAGACCAGAGGGGAAATGG + Intronic
1172180432 20:33000236-33000258 CAGGGAGAGAAGAAGGGATAGGG - Intronic
1172330593 20:34073796-34073818 CTGGGGAAACAAAGGGGAGAGGG - Intronic
1172331080 20:34076679-34076701 CTGGGAGTGGAGGGGGGACAGGG - Intronic
1172375738 20:34438451-34438473 CTGGGTAAGAAGAGGGGAAAAGG - Intronic
1172458455 20:35096028-35096050 CTGGCAGAGCAGAGGTGAAGTGG - Intergenic
1172718698 20:36983115-36983137 AAGAGAGAGCAGAGGAGAGAAGG - Intergenic
1172763855 20:37340521-37340543 ATGGGAGGGCAGAGGGCAGCCGG - Intergenic
1172997613 20:39082845-39082867 CTGGGAGAGACAAGGAGAGAAGG + Intergenic
1173427367 20:42954861-42954883 ATGGAAGAGGAGAGGAGAGAAGG + Intronic
1173500682 20:43550553-43550575 CTGGGAGCGCAGAGAGGGGAGGG + Intronic
1173528254 20:43749370-43749392 CTGGGGGAGAGGAGGGGACATGG - Intergenic
1173561933 20:44012378-44012400 CTGGGAGAGCCTCGGGCAGATGG + Intronic
1173869594 20:46332944-46332966 CTGGAAGAGGGGAGGGGAGGGGG + Intergenic
1174020832 20:47526783-47526805 AGGGGAGAGGGGAGGGGAGAGGG + Intronic
1174090201 20:48040542-48040564 CTGGGAAATCAGAGAGGAGACGG + Intergenic
1174303756 20:49600692-49600714 CTCTGAGAGCAGAGGGGAGGGGG - Intergenic
1174543699 20:51309089-51309111 ATGGGAGAGGAGAGGGGATGAGG - Intergenic
1174607347 20:51770411-51770433 CTAGCAAAGCAGATGGGAGATGG - Intergenic
1174774486 20:53331497-53331519 CTCTGAGGGGAGAGGGGAGAGGG + Intronic
1175120241 20:56711054-56711076 GAGGGAGAGGAGGGGGGAGAGGG - Intergenic
1175196773 20:57249384-57249406 CTGGGAGAGAAACTGGGAGAAGG + Intronic
1175237708 20:57525572-57525594 CTGGGAGATCTGAGGGGGAATGG + Intronic
1175299433 20:57932456-57932478 GTGGGTGAGCAGAGGGGTCAAGG + Intergenic
1175343818 20:58254821-58254843 CTGGGCATGCACAGGGGAGATGG + Intergenic
1175372603 20:58502047-58502069 CTGTGAGAGGAGAGGAGAAAGGG - Intronic
1175443395 20:59005744-59005766 TTGGGAGAGAAGGCGGGAGAAGG - Intronic
1175539060 20:59736845-59736867 CAGGGAAGGCAGAGGGGAGAGGG + Intronic
1175605876 20:60311857-60311879 GTGGCAGAGCATAGGGGAGCAGG + Intergenic
1175738829 20:61406361-61406383 CGGGCAGAGCAGATGGCAGATGG - Intronic
1175738848 20:61406452-61406474 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738853 20:61406480-61406502 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738867 20:61406550-61406572 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738895 20:61406690-61406712 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738900 20:61406718-61406740 CGGGCAGAGCAGATGGCAGATGG - Intronic
1175738927 20:61406851-61406873 CGGGCAGAGCAGATGGCAGATGG - Intronic
1175738942 20:61406921-61406943 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175936133 20:62514895-62514917 CTGGGAGAGGTGAGGGGAGTCGG + Intergenic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176019963 20:62957497-62957519 GTGGGCGAGCAGTGGGGTGACGG - Exonic
1176198255 20:63847856-63847878 CTGGGGGAGGAGAGGGGAAGTGG - Intergenic
1176551347 21:8223836-8223858 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1176570256 21:8406835-8406857 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1176578165 21:8451022-8451044 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1177564109 21:22796209-22796231 TGGGGAGACCAGAAGGGAGATGG + Intergenic
1177816948 21:25988020-25988042 TCGGGAGAGCTGAGGGGAGAGGG + Intronic
1178127471 21:29530597-29530619 ATGGGAGAGGAGAGGGTTGAAGG + Intronic
1178641149 21:34345566-34345588 CTGGGGGTGCAGAGGTGTGAAGG + Intergenic
1178667588 21:34562474-34562496 GTGGGAGAGCAGAGGCGACATGG + Intronic
1178810936 21:35880800-35880822 CTGGTGGAGAAGAGGGGGGAAGG - Intronic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179034922 21:37751410-37751432 CAGGGAGAGCAAACGGGAGGTGG + Intronic
1179084815 21:38207422-38207444 AAGGGAGAGGAGAAGGGAGAAGG - Intronic
1179186853 21:39091488-39091510 CTGAGAGAGGAGAGGGGACAGGG - Intergenic
1179597943 21:42455670-42455692 CTGGGAGAGGGAAGGAGAGAGGG + Intergenic
1179646988 21:42782113-42782135 AAGGGAGAGGAGAGAGGAGAGGG - Intergenic
1180003562 21:45007607-45007629 CTCGGAGAGCAGAAGGGGGATGG - Intergenic
1180136715 21:45866772-45866794 AGGGGAGAGGAGAGGGGAGGGGG - Intronic
1180246887 21:46554482-46554504 CTGCGAGAGAGGAGGGGAGGTGG - Intronic
1180315255 22:11272131-11272153 CTGGGGGAGAAGCGGGGACAAGG + Intergenic
1180340092 22:11611339-11611361 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1180669028 22:17538456-17538478 CTGAGAGAGCTCAGGAGAGAAGG + Intronic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181533533 22:23530440-23530462 GTGGGGGAGCAAAGGGGGGATGG - Intergenic
1181539591 22:23566268-23566290 CTGGGAGAGGAGAGGGCAGGGGG + Intergenic
1181765025 22:25085273-25085295 CTGGGAGGGCAGAGGAGCCAAGG + Intronic
1181922382 22:26330484-26330506 CTAGCAGAGAAGAGAGGAGAGGG + Intronic
1181947501 22:26529479-26529501 CTGGGAGGGGAGAGGGGAGAGGG + Intronic
1182027785 22:27134095-27134117 CAGGGAGGGCAGAGGGGATGGGG + Intergenic
1182257379 22:29048960-29048982 CAGGCAGAGCAGTGGGGAGTTGG + Intronic
1182459961 22:30476509-30476531 CTGGGCAAGGGGAGGGGAGATGG - Intergenic
1182476448 22:30579141-30579163 CTGGAAGAGCAGAGGATGGAGGG - Exonic
1182557357 22:31136527-31136549 CTGGGGCAGCAGGGGGTAGAGGG + Intronic
1183192812 22:36332546-36332568 CTGGGAGATCACAGGGGCTATGG - Intronic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183460508 22:37947220-37947242 CTGGGGGAGGACAAGGGAGAGGG - Intronic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1183495846 22:38143303-38143325 CAGGGTGAGCAGAGGTGAGCAGG + Intronic
1183578377 22:38706556-38706578 GCGGGACAGCAGAGGGGCGAGGG + Intronic
1183630999 22:39032467-39032489 CTGGGAGAGCGGGGAGGAGGTGG - Exonic
1183634507 22:39052846-39052868 CTGGGAGAGCGGAGAGGAGGTGG - Exonic
1183701303 22:39452729-39452751 CTGGGAGGGTAGAGGGTGGAGGG + Intergenic
1183724235 22:39579579-39579601 GTGGAAGGGCAAAGGGGAGAAGG + Intronic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1184092369 22:42299412-42299434 CTAGGAGTGGGGAGGGGAGATGG - Intronic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1184335491 22:43850590-43850612 GAGGGAGAGCAGAGGGAACAGGG - Intronic
1184872420 22:47249434-47249456 ATGGGAGAGAAGTAGGGAGAGGG - Intergenic
1184949909 22:47833922-47833944 CTGAGATTGCAGAGAGGAGACGG + Intergenic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185032796 22:48453563-48453585 CTGAGAGAGCAGATGGGGCAAGG + Intergenic
1185355568 22:50367535-50367557 CTGTGACAGCATAGGAGAGACGG - Intronic
1203256370 22_KI270733v1_random:140780-140802 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
949343887 3:3058717-3058739 ATGGGAGAGAAGGGTGGAGAAGG - Intergenic
949382820 3:3464997-3465019 AAGGGAGGGAAGAGGGGAGATGG + Intergenic
949494559 3:4619617-4619639 AGGGGAGAGCAGAGGAGAGCAGG - Intronic
949494563 3:4619637-4619659 AGGGGAGAGCAGAGGAGAGCAGG - Intronic
949494567 3:4619657-4619679 AGGGGAGAGCAGAGGAGAGCAGG - Intronic
949494571 3:4619677-4619699 AGGGGAGAGCAGAGGAGAGCAGG - Intronic
949494575 3:4619697-4619719 AGGGGAGAGCAGAGGAGAGCAGG - Intronic
949494579 3:4619717-4619739 AGGGGAGAGCAGAGGAGAGCAGG - Intronic
949499721 3:4668249-4668271 GTGGGAGGGCAGGGGGGAGGTGG - Intronic
949549895 3:5104138-5104160 CTGGGGGAGGAGGGGGGAGGAGG - Intergenic
949551332 3:5114690-5114712 CGGAGAGGGGAGAGGGGAGAGGG + Intergenic
950105974 3:10388693-10388715 GTGGTAGAGGAGTGGGGAGAAGG - Intronic
950118162 3:10464535-10464557 CAGGCAGAGAAGAGAGGAGAGGG - Intronic
950334387 3:12182037-12182059 TTGGGAGAGCAGCTGGGAGGGGG - Intronic
950359774 3:12441907-12441929 CTGGTAGAGAAGAGTGGAGGGGG + Intergenic
950407637 3:12814631-12814653 CTGGGACTCCAGAAGGGAGAAGG - Intronic
950465801 3:13153090-13153112 GAGGGAGGGGAGAGGGGAGAAGG - Intergenic
950545628 3:13636422-13636444 CTGGGGGAGAAGAGGGGCAATGG - Intronic
950725987 3:14917370-14917392 CAGGGAGACCCCAGGGGAGAAGG + Intronic
950806057 3:15603961-15603983 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
951264901 3:20553199-20553221 CAGGGAGGGCAGAGGGGCGTGGG + Intergenic
951280415 3:20742122-20742144 GTGGGAAAGCAGAGGGGGTAGGG - Intergenic
952268083 3:31806205-31806227 CTGGGAGGGCTGAGGGAACAAGG - Intronic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
952906750 3:38144132-38144154 CAGGGAGAGAATTGGGGAGAGGG + Intergenic
952914424 3:38222477-38222499 CTGCAAGAGCAGAGTGGGGAGGG + Intronic
953194344 3:40718193-40718215 TGGGGAGGGCAAAGGGGAGAGGG + Intergenic
953262755 3:41356143-41356165 CAGGGAGAACACAGGGGACAGGG - Intronic
953369859 3:42378202-42378224 CTGGGAGAAACTAGGGGAGATGG - Intergenic
953397666 3:42585945-42585967 CTGGGAGAGCAAGCGGGGGAGGG - Intronic
953567133 3:44042308-44042330 CTGTTAGAGGAGAGGGGAAATGG + Intergenic
953658298 3:44871497-44871519 CTTGGAGAGCAGAGAGCAGAGGG + Intronic
953821205 3:46208887-46208909 CTTGGGGAGCAGAGAGCAGAGGG - Intronic
954092142 3:48293634-48293656 GTGGGAGAACAGAGGAAAGAAGG - Exonic
954103433 3:48395938-48395960 CTTGGAGAGGAGATGGGAGTGGG - Intronic
954331840 3:49895365-49895387 CAGGGAGTGCTGTGGGGAGAGGG + Exonic
954367410 3:50154056-50154078 GAGGGAGAAGAGAGGGGAGAAGG + Intergenic
954681554 3:52348818-52348840 GTGAATGAGCAGAGGGGAGATGG - Intronic
954792596 3:53144234-53144256 CTGGGACAGCAGAATGGAGAAGG - Intergenic
954912734 3:54122517-54122539 CGGGGAGGGCGGAGAGGAGAGGG - Intergenic
955059489 3:55483329-55483351 CTGGGATTGAAGAGGGAAGAGGG - Intronic
955144370 3:56301493-56301515 GGGGGAGAGAAGAGGGGAGAGGG - Intronic
955269535 3:57483159-57483181 CTAGAAGAGGACAGGGGAGAAGG + Intronic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
955393369 3:58537068-58537090 CTGGGAGACCCCAGAGGAGAGGG - Intronic
955592346 3:60551484-60551506 AGGGGAGAGGGGAGGGGAGACGG + Intronic
955793753 3:62613936-62613958 CGGGGAGCACAGAGGGGAGTAGG - Intronic
955863363 3:63355772-63355794 GGTGGAGAGCAAAGGGGAGAGGG - Intronic
955871491 3:63443023-63443045 CTGGCAGAGTAAAGGGGAGATGG + Intronic
956221559 3:66909397-66909419 TTGGGAGGGTAGTGGGGAGAGGG + Intergenic
956519204 3:70085027-70085049 CAGTGATGGCAGAGGGGAGAGGG + Intergenic
956778617 3:72587160-72587182 ATGGGGGAGCTGAAGGGAGATGG - Intergenic
957311556 3:78526151-78526173 CTGGGGAAGGAGAGGGGAGGAGG - Intergenic
957891480 3:86364493-86364515 CAGGAAGAGCAGAGGGGTCAAGG + Intergenic
958173886 3:89970875-89970897 GGGGGACAGGAGAGGGGAGAGGG + Intergenic
958870946 3:99558322-99558344 CTGGGACAGTAGATGGGGGAAGG + Intergenic
959167097 3:102793948-102793970 AGGGGAGGGGAGAGGGGAGAGGG + Intergenic
959208696 3:103346806-103346828 CTGGGAGAGTGTAGGGGAAATGG + Intergenic
959995887 3:112679602-112679624 CTGGGAGTGCAGTGGGTAAAGGG - Intergenic
960051254 3:113241414-113241436 CCGGGAGAGCAGAGGGGGAGAGG - Intronic
960232081 3:115240006-115240028 GTGGGAGAGAGGAAGGGAGAGGG + Intergenic
960953094 3:123012322-123012344 TTGGGAGAACATGGGGGAGAAGG - Intronic
961044838 3:123701094-123701116 GTGGGAGGGTAGAGGGGAGCGGG + Intronic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961144762 3:124584694-124584716 CGGGGAGAGCACAGCGGGGAGGG + Intronic
961471458 3:127115745-127115767 CTTGGAGAGGAGTGGGGACAGGG + Intergenic
961514633 3:127425019-127425041 ATGGGAGAGGAGAGAGGAGAAGG + Intergenic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
962202719 3:133414442-133414464 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962202833 3:133414916-133414938 AGGGGTGAGCAGAGGGGACAGGG - Intronic
962202843 3:133414951-133414973 AGGGGTGAGTAGAGGGGAGATGG - Intronic
962202929 3:133415293-133415315 AGGGGCGAGTAGAGGGGAGAGGG - Intronic
962203077 3:133415850-133415872 GAGGGTGAGTAGAGGGGAGAGGG - Intronic
962203201 3:133416374-133416396 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203209 3:133416398-133416420 AGGGGAGAGTAGAGGGGAAAGGG - Intronic
962203255 3:133416605-133416627 AGGGGTGAGTAGAGGGGAGATGG - Intronic
962203330 3:133416903-133416925 ACGGGTGAGTAGAGGGGAGAGGG - Intronic
962203375 3:133417090-133417112 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
962203460 3:133417397-133417419 TGGGGTGAGTAGAGGGGAGATGG - Intronic
962203478 3:133417468-133417490 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203538 3:133417717-133417739 ACGGGTGAGTAGAGGGGAGATGG - Intronic
962203583 3:133417917-133417939 ACGGGTGAGTAGAGGGGAGATGG - Intronic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
963235046 3:142947743-142947765 ATGGGAGAGCTGAGGGGAACTGG - Intergenic
963751149 3:149181179-149181201 CAGGGAGAGCAGGGGCCAGATGG - Intronic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965370056 3:167851101-167851123 CTGGGATAGAAGAGTGGAAATGG - Intergenic
965885690 3:173444442-173444464 CTGGGAGAAAAGATGGCAGAAGG - Intronic
966093358 3:176167643-176167665 TGAGGAGAGCAGAGGGGAAAAGG + Intergenic
966462786 3:180196227-180196249 ATTGGAGAGGAGAGGGGAAAGGG - Intergenic
966656571 3:182364965-182364987 ATTGGAGAGAAAAGGGGAGAGGG + Intergenic
967195520 3:187022305-187022327 GTGTGAGAGCAGAGGAAAGATGG + Intronic
967218865 3:187232520-187232542 CTGGAAAAACAAAGGGGAGAAGG - Intronic
967847919 3:194058547-194058569 CGGGGAGAGAAGAGGGGAGTGGG + Intergenic
967947897 3:194818587-194818609 GTGGGTGAGGAGAGGGGAGAGGG - Intergenic
967953951 3:194862871-194862893 CTGGGAGAGGAGGAGGCAGAGGG - Intergenic
968443033 4:634096-634118 CTGGGAGGCCAGAGGGGTGGAGG + Intronic
968606658 4:1538511-1538533 GTGGGAGGGCAGAGGTGGGAGGG + Intergenic
968614369 4:1570794-1570816 CTGAGACAGGAGAGGAGAGAGGG + Intergenic
968641294 4:1716381-1716403 CTGGGAGACCCTAGGGGAGTGGG + Exonic
968643203 4:1725374-1725396 CTGGAGGGGTAGAGGGGAGACGG - Intronic
968647801 4:1749003-1749025 GAGGGAGAGCAGTGGGGAGGGGG - Intergenic
968663688 4:1809614-1809636 TAGGGAGAGCAGAGGGGATGGGG - Intergenic
968767213 4:2478841-2478863 CTGGTAGAGCTGTGGGAAGAGGG + Intronic
969048543 4:4356366-4356388 CTGGGAGAGCAGGGGAGACGTGG + Intronic
969060021 4:4426886-4426908 CTGTCAGAGCAGAGCTGAGATGG - Intronic
969219900 4:5752704-5752726 CTGGGAGAGCGGAGCTCAGAGGG - Intronic
969352552 4:6606167-6606189 GAGGGAGAGAAGAAGGGAGAGGG + Intronic
969762792 4:9201792-9201814 ATGGGAGAGCAGATGGCAGAAGG + Intergenic
970558358 4:17258486-17258508 CTGGGAATTCAGAGGAGAGATGG - Intergenic
970579101 4:17458033-17458055 CTCAGACAGCAGAGGGCAGAAGG - Intergenic
970889869 4:21031072-21031094 CTTGGAGACCAGATGGAAGATGG - Intronic
970982514 4:22117253-22117275 CTGTAATAGCAGAGGGGAAAAGG + Intergenic
971376034 4:26056443-26056465 CTGGCAGAAAAGAGGGGAGAGGG - Intergenic
971412102 4:26384937-26384959 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
971412108 4:26384949-26384971 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
971677625 4:29654028-29654050 GTGGGCTAGCAGAAGGGAGAGGG + Intergenic
971744883 4:30566707-30566729 CTGTGAAAGCAGCTGGGAGAAGG + Intergenic
971996866 4:33975849-33975871 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
972325375 4:38010580-38010602 GAGGGAGTGCAGAGTGGAGAAGG - Intronic
973808637 4:54549031-54549053 CTGGGACAGCCGAGGGAAGGGGG + Intergenic
973942000 4:55920502-55920524 CTGAGATAGCAAAGGGGAAAAGG + Intergenic
974089205 4:57293231-57293253 CTGGCAGAGCAGGGGAGAAATGG + Intergenic
974508573 4:62807849-62807871 GTGGGAGAGCAGAGGGGGTAGGG + Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
976556117 4:86453173-86453195 CTGGGAAAGCTGCAGGGAGAAGG + Intronic
976613943 4:87057243-87057265 AGAGGAGAGCAGTGGGGAGATGG + Intronic
976894044 4:90085708-90085730 CTGAGAGAGAAGAGGGAATAGGG - Intergenic
977076165 4:92453219-92453241 CTGGGAAAGGAGGGGAGAGAAGG + Intronic
977294277 4:95193731-95193753 CTGGCAGAGAACAGGAGAGAAGG - Intronic
977869394 4:102071963-102071985 CTAGGAGAGCAGGGAGTAGAAGG + Intronic
978202916 4:106044201-106044223 CTGAGAAAGCAGAGAAGAGAGGG - Exonic
978739260 4:112119065-112119087 AGGGGAGAGGAGAGGGGAGAGGG + Intergenic
980239250 4:130152240-130152262 CTGGAAGGGTAGTGGGGAGAAGG + Intergenic
980896941 4:138869004-138869026 AGGGGAGAGGGGAGGGGAGAGGG + Intergenic
981001531 4:139833462-139833484 GTGGGAGAGCAGAGGCGTGGAGG + Intronic
981783865 4:148455898-148455920 ATAGGAGAGGAGAGGAGAGAAGG - Intergenic
982148875 4:152429385-152429407 GCGGGGGAGGAGAGGGGAGAAGG + Intronic
982338705 4:154270640-154270662 CTGTGAGAACAGAGAAGAGAGGG + Intronic
982481009 4:155909921-155909943 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
982772384 4:159408797-159408819 ATGGGAGAGCAGGTGGGGGAAGG - Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984273899 4:177584110-177584132 CAGGGAAAGCAAAGGCGAGAAGG - Intergenic
984702829 4:182829061-182829083 CTGGGGAGGCAGAGGGGAGGAGG + Intergenic
984853664 4:184175070-184175092 CTGGGAGCCAAGAGGAGAGACGG - Intronic
984918417 4:184743482-184743504 AGGGGAGGGCAGAGGGAAGAGGG + Intergenic
985109380 4:186533605-186533627 CTGGGAAAGCAGAGTGGTGGAGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985721139 5:1489859-1489881 CTGGAAGAGAGGAGGGGAGACGG + Intronic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
985824900 5:2184962-2184984 CTGCCAGGGCAAAGGGGAGAGGG - Intergenic
985912994 5:2897573-2897595 GTGGGTGGGCAGAGGGGAGTTGG - Intergenic
986038163 5:3960670-3960692 CTGGGAGAGCATGCTGGAGATGG + Intergenic
986222056 5:5776699-5776721 TGGGGAGAGAGGAGGGGAGATGG - Intergenic
986278873 5:6306368-6306390 CTGGGTGGGCCGAGGGGAGGGGG - Intergenic
986434938 5:7720162-7720184 AGGGGAGAGAAGAGGAGAGAAGG - Intronic
986734047 5:10655163-10655185 CAGGGAGAGAAGCGGGCAGAGGG - Intergenic
986750707 5:10784904-10784926 TGGGGAGAGTAAAGGGGAGAGGG + Intergenic
986755503 5:10832179-10832201 GTGGCACAGCAGTGGGGAGAAGG + Intergenic
987245163 5:16041525-16041547 CTGTGGGGGCAGAGGGGAGGGGG - Intergenic
987314661 5:16713197-16713219 CTGGGAGAAAAGAGGGGATCAGG - Intronic
987351467 5:17025896-17025918 TTGGGGGAGGGGAGGGGAGAGGG + Intergenic
988669137 5:33362270-33362292 CTGGGAGAGAAGTGCGGAGTAGG - Intergenic
988858504 5:35252662-35252684 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
989110437 5:37902048-37902070 CTGGGTGAGTTGAGGGGATATGG + Intergenic
989199882 5:38752589-38752611 ATGTGAGAGCAGAAGGGAAAAGG - Intergenic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
990019452 5:51107416-51107438 CAGGTAGAGGAGAGGGGAGACGG - Intergenic
990495690 5:56345620-56345642 CTGGCAGAGAGGAAGGGAGAGGG + Intergenic
990523176 5:56599510-56599532 CAGGGAGACCTGAGGGGAGGAGG + Intronic
990943871 5:61230152-61230174 GGGTGAGAGGAGAGGGGAGAGGG - Intergenic
990948729 5:61275889-61275911 CTCTGAGAACAAAGGGGAGAGGG - Intergenic
992006934 5:72487531-72487553 GAGGGAGAGAGGAGGGGAGAAGG - Intronic
993068131 5:83126642-83126664 CTGGTAGAGCTGTGGGAAGAAGG + Intronic
993085776 5:83361954-83361976 GTGGGAAAGCAGAGAGGAGAGGG - Intergenic
993170666 5:84415166-84415188 CTGGGAGAGGGGAGTGGAAATGG - Intergenic
994220034 5:97184631-97184653 CTGGGAAAGATGAGGGGAGTGGG - Intergenic
994590704 5:101768719-101768741 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
994789067 5:104200979-104201001 CTGCGAGAGCTGATGTGAGAGGG - Intergenic
994916621 5:105988834-105988856 CTGGGAGGGGAGGTGGGAGATGG + Intergenic
995078225 5:108013480-108013502 ATGGGAGAACAGAGAGGAGAAGG - Intronic
995157221 5:108930346-108930368 AGGGGAGAGGAGAGGGGAGGCGG - Intronic
995180850 5:109228907-109228929 CGGGGAGAGGAAAGGGGAGAGGG + Intergenic
995184089 5:109253655-109253677 CTGGGAGAGAAGGCAGGAGAGGG - Intergenic
995583678 5:113624960-113624982 CTCGGAGAAGAGAGGCGAGAAGG + Intergenic
995821104 5:116233792-116233814 TTGGAAGAGGAGAGGTGAGAGGG + Intronic
996097170 5:119411130-119411152 GTGGGAGAAAAGATGGGAGAAGG - Intergenic
996626286 5:125573850-125573872 CTGGCAGAGAAAAGGAGAGAGGG - Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
997583096 5:135029322-135029344 CTGGGGGAGGGGACGGGAGAAGG + Intronic
997662208 5:135598065-135598087 CTAGGAGAGTAGAATGGAGATGG + Intergenic
997942223 5:138168512-138168534 CTCTGACAGCAGAGGGGAGGGGG + Intronic
998127356 5:139633711-139633733 CGGGGAGGGCAGAGGGGAGCTGG - Intergenic
998374573 5:141682246-141682268 GAGGGAGGGCAGAGGGGAGGCGG - Intergenic
998391254 5:141788406-141788428 CTGTTAGGGTAGAGGGGAGAAGG - Intergenic
998849803 5:146341845-146341867 ATGGAAGAGGAGTGGGGAGAAGG - Intergenic
999283069 5:150377451-150377473 CTGGAAGAGCTGAGAGAAGATGG + Intronic
999314734 5:150576248-150576270 CAGGGAGAGCAGGGGAGAGCAGG + Intergenic
999383965 5:151141206-151141228 CTGGGAGAGCAGCTGAGAGCTGG + Intronic
999435530 5:151560482-151560504 CCGGGAGAGCAAATGGGCGAGGG - Intronic
1000082294 5:157859275-157859297 TTGGGAGAGCTGAGAGGAGTTGG + Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1001046292 5:168374553-168374575 ATGAGTGAGGAGAGGGGAGAAGG + Intronic
1001128443 5:169042482-169042504 CTAGGAGAGCAGAGGGGCACCGG - Intronic
1001170672 5:169416234-169416256 CTGGGAGGGCAGCTGGGAGCAGG + Intergenic
1001202937 5:169735930-169735952 ATGGCAGAGCAGGGGGGAGAGGG + Intronic
1001314558 5:170633079-170633101 GGGGGAGAGCAGAGGGAAGGGGG + Intronic
1001576132 5:172765177-172765199 CTCGGTGGGCAGAGGGGAGCAGG + Intergenic
1001810825 5:174626937-174626959 CTGGAAGAGCAGAGGGTATTTGG + Intergenic
1001913422 5:175540092-175540114 GTGTGAGAGCAGAGGGGTGGAGG + Intergenic
1002100333 5:176854535-176854557 CTGGGGAAGCAGAGGGGTCAGGG - Intronic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002522237 5:179798280-179798302 GTGGGAGGGCAGTGGTGAGAGGG + Intronic
1003263539 6:4546749-4546771 CTTGAAGACCACAGGGGAGAGGG - Intergenic
1003480000 6:6522158-6522180 GTGTGAGTGCAGTGGGGAGAAGG - Intergenic
1004263882 6:14132343-14132365 CTTGCAGAGGAGAGTGGAGAGGG + Intronic
1004653066 6:17630718-17630740 AGGGGAGACAAGAGGGGAGAGGG + Intronic
1004653071 6:17630730-17630752 AGGGGAGAGGGGAGGGGAGAAGG + Intronic
1004653080 6:17630749-17630771 AAGGGAGGGGAGAGGGGAGAGGG + Intronic
1005994482 6:30922998-30923020 CGGGGTGAGCAGAGGGCAGCGGG + Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006174106 6:32111539-32111561 CTGGGAGAGAGGAGGGGGAAAGG + Intronic
1006283829 6:33078133-33078155 GTGGGGGAGCAGAGAGCAGAAGG + Intronic
1006683699 6:35814997-35815019 CTGAGAGTGTAGAGGGGTGAGGG - Intronic
1006729066 6:36222082-36222104 CAGAGAGGGGAGAGGGGAGAAGG + Intronic
1006745593 6:36339674-36339696 CTGGGAGGGAAGATGGCAGAGGG + Intergenic
1006817674 6:36863911-36863933 CTGTGAAAGCAGAGGGGCGGAGG - Intronic
1006897154 6:37478556-37478578 CCTGGCGAGGAGAGGGGAGAGGG - Intronic
1006988560 6:38193702-38193724 CTGTGAGAGCGGAGGAGGGATGG - Intronic
1007091129 6:39185566-39185588 CTGGGAGCCCAGTGTGGAGAGGG - Intergenic
1007134309 6:39506901-39506923 CTGGGAGGGCAGTGTGCAGAGGG + Intronic
1007150731 6:39688231-39688253 CTGGGAGGCCAGAGGGCAGGAGG + Intronic
1007165791 6:39828029-39828051 CTGTGGGAGCACAGGTGAGAGGG - Intronic
1007180090 6:39923490-39923512 GTGAGAGAGCAGAGGGGATGAGG - Intronic
1007221824 6:40284691-40284713 CTAGCAGAGCAGAAAGGAGAAGG - Intergenic
1007371954 6:41431953-41431975 CTGGGAGAGGTGAGAGGAGATGG + Intergenic
1007385410 6:41517156-41517178 GTGGGAGAGCAGAGGAGGCAGGG + Intergenic
1007414305 6:41683154-41683176 CGTGGAGAGCAGAGGGGAACTGG + Intergenic
1007511350 6:42376477-42376499 CCAGAAGGGCAGAGGGGAGAGGG + Intronic
1007654364 6:43443304-43443326 CTGGGAGAACAGGAGGGAAAAGG + Intronic
1007945846 6:45826283-45826305 CTTGGATAACAGATGGGAGATGG + Intergenic
1008538888 6:52529262-52529284 CTGGGAAAGCTGGGGGGAGGTGG - Intronic
1011170998 6:84504176-84504198 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011566955 6:88685517-88685539 TTCAGAGAGGAGAGGGGAGAAGG + Intronic
1011908936 6:92410443-92410465 CTCTGGGAGCAGAGGGGAGTAGG - Intergenic
1012365777 6:98437776-98437798 TAGGGAGAGTGGAGGGGAGATGG + Intergenic
1012457890 6:99427349-99427371 CTTGGAGGGCAGAGGTGAGGGGG - Intergenic
1012535627 6:100293224-100293246 TTGGGAGGGGAGAGGGGAAAAGG - Intergenic
1013386331 6:109635484-109635506 CTGGGAGAGAAGTGGTGGGAGGG - Intronic
1013629035 6:111967335-111967357 ATGGGAGAGCAGACGGGAAGAGG - Intergenic
1014735000 6:125083036-125083058 CTGGGAGATGAGATGGTAGAAGG - Exonic
1014839190 6:126197833-126197855 TTGGGAGAGCTGAGGGCAGCTGG - Intergenic
1016286934 6:142484218-142484240 CTGGGAGTGGGGAGAGGAGAGGG - Intergenic
1016403269 6:143703226-143703248 CTGGGGGAATAGAGGTGAGAGGG + Intronic
1016546423 6:145229267-145229289 GTGGGAGAGGGGAGGGGAGGAGG - Intergenic
1016919976 6:149283146-149283168 GCGGGAGAGCAGAGGGGAGCTGG - Intronic
1017013341 6:150080008-150080030 CTTGGAGGGCAGATGGGGGAAGG - Intergenic
1017101064 6:150850303-150850325 CTCGGAGAAGAGAGGTGAGAGGG - Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017521772 6:155208966-155208988 CGGGGTGGGCAGCGGGGAGAGGG - Intronic
1017876566 6:158529733-158529755 CAGGGAGAGCAGGGAAGAGATGG - Intergenic
1018205731 6:161435952-161435974 ATGGGAGGGCAGAGAGGAGGGGG + Intronic
1018205742 6:161435979-161436001 ATGGGAGGGCAGAGAGGAGGGGG + Intronic
1018205753 6:161436006-161436028 ATGGGAGGGCAGAGAGGAGGGGG + Intronic
1018205791 6:161436143-161436165 ATGGGAGGGCAGAGAGGAGGGGG + Intronic
1018205806 6:161436197-161436219 ATGGGAGGGCAGAGAGCAGAGGG + Intronic
1018205839 6:161436307-161436329 ATGGGAGGGCAGAGAGGAGGAGG + Intronic
1018226915 6:161637588-161637610 CTGGGAACGCAGAGGAGAAAAGG - Intronic
1018747668 6:166774954-166774976 TTGGGAGGGCAGAGGAGAAACGG + Intronic
1018874428 6:167807430-167807452 CTGGGAGTGCAGGGCGGAGCAGG + Intergenic
1019064672 6:169287216-169287238 GAGGGACAGCAGAGGGGAGAGGG + Intergenic
1019136354 6:169911119-169911141 GGGGAAGGGCAGAGGGGAGACGG + Intergenic
1019303196 7:319525-319547 CTCGGAGATCAGCAGGGAGAAGG + Intergenic
1019354766 7:572706-572728 CCTGGAGAGCCGAGGGGAGCAGG + Intronic
1019427309 7:983694-983716 TAGGGACAGCAGAGGGGAGGAGG + Intronic
1019484577 7:1283603-1283625 CTGGGAGTGAAGAGGGGTGTGGG + Intergenic
1019491247 7:1314597-1314619 CAGGGAGAGCAGTGGGGAAGAGG - Intergenic
1019576367 7:1739571-1739593 CTGGGAGAGCTGGGGAGAGGAGG + Intronic
1019645019 7:2124430-2124452 CTGGGAGATGAGTGGGCAGAAGG + Intronic
1019693938 7:2434091-2434113 GTGGGCGGGCGGAGGGGAGAGGG - Exonic
1019738956 7:2663424-2663446 ATGGGAGGGCAGAGTGGGGAGGG + Exonic
1020451331 7:8323486-8323508 GGGGGAGAGCTGAAGGGAGATGG + Intergenic
1020598399 7:10241590-10241612 ATGGGAGAGAAGTGGAGAGAGGG - Intergenic
1020727409 7:11832378-11832400 GGGGGCGAGCAAAGGGGAGAGGG + Intergenic
1021527525 7:21605459-21605481 CAGGGAGAGCAGAGTTGAGTTGG + Intronic
1021590367 7:22254717-22254739 CTTGGAGAGGAAGGGGGAGATGG + Intronic
1021652336 7:22844417-22844439 CTGGGTGAGATGAGGGGAGTTGG + Intergenic
1022251199 7:28610224-28610246 CTGGGTGAACAGTGGGGAGCTGG + Intronic
1022318859 7:29269197-29269219 CTGGCAGAGTAGTGGGGAGAGGG - Intronic
1022327658 7:29346538-29346560 CTGGGAGAGGGGATGGCAGAGGG + Intronic
1022569946 7:31442525-31442547 ATGAGAGAGCAGAGAGGAGACGG + Intergenic
1022791477 7:33693468-33693490 ATGGGAGAGTAGGGGGGTGATGG + Intergenic
1022946433 7:35289732-35289754 CTGGGATAGAAGTGGGGAAAAGG - Intergenic
1023062680 7:36343454-36343476 AGGGGAGAGGGGAGGGGAGAGGG + Intronic
1023062686 7:36343466-36343488 AGGGGAGAGGGGAGGGGAGAGGG + Intronic
1023965637 7:44961965-44961987 CTGAGAGAGCTGAGGGCTGAGGG + Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024270151 7:47635805-47635827 GGGGGAGAAGAGAGGGGAGAAGG + Intergenic
1024304955 7:47921875-47921897 GGGGGAGGGGAGAGGGGAGAGGG - Intronic
1024323883 7:48093775-48093797 CAGGGGGAGCAGCGGGGACAGGG - Intronic
1024604144 7:51011041-51011063 CTGATGGAGCAGAGGGCAGACGG - Intergenic
1024655741 7:51450003-51450025 TTGGGAGAGCAGGGGGCAGAGGG - Intergenic
1025033483 7:55575610-55575632 CTGGAAGAGCAGTGAGGAGATGG + Intergenic
1025036290 7:55594317-55594339 CTGGGAGAGGTGCTGGGAGAAGG - Intergenic
1025094656 7:56087777-56087799 CTGGGAGTGCAGAGGACAGATGG + Intronic
1025110379 7:56211501-56211523 CAGGGAGAGGTGAGGGGAGCAGG + Intergenic
1025683654 7:63699369-63699391 CTGGGAGTGCAAAGGACAGATGG - Intergenic
1026101867 7:67390380-67390402 CTGGGAGAGTTGTGGGGAGAGGG + Intergenic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026364352 7:69632601-69632623 CAGAGAGGGAAGAGGGGAGAGGG - Intronic
1026790051 7:73325609-73325631 CTGGGAAAGGGGAGGAGAGAAGG - Intronic
1026968170 7:74453542-74453564 CTGGGAGAGCAGCCGGGCGCAGG - Intergenic
1027228796 7:76260675-76260697 CTGGGAGGGCAGAGGGGGACTGG - Intronic
1028730906 7:94147282-94147304 CTTGGAGGGAAGAAGGGAGATGG - Intergenic
1028842103 7:95439811-95439833 CTGGGAGAAAAGAGGGGAGCAGG + Intergenic
1028905753 7:96152327-96152349 CCTAGGGAGCAGAGGGGAGAGGG + Intronic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG + Intergenic
1029238578 7:99143331-99143353 CGGGGAGAGGTGAGGGGAAAGGG + Intronic
1029547125 7:101216515-101216537 CTGGGAGAGGAGTGGCGAGGGGG - Exonic
1030116868 7:106068668-106068690 CTGGGAGAGCAGGTGGGAGGTGG - Intergenic
1030684567 7:112471450-112471472 CAGGGAGAGGAGAAAGGAGATGG - Intronic
1031131063 7:117833690-117833712 CTTGGAGGACAGAGAGGAGATGG - Intronic
1031662683 7:124445767-124445789 GTGTGAGGGCTGAGGGGAGAAGG - Intergenic
1031928148 7:127657738-127657760 TTGGGAGGCCAGAGTGGAGAAGG - Intronic
1031955396 7:127937446-127937468 GAGGGAGAGGAGAAGGGAGAAGG - Intronic
1032091638 7:128914446-128914468 CTGGGAGAGCTTTGGGGAGGAGG + Intergenic
1032110532 7:129071689-129071711 CATGCAGAGCAGAGGTGAGATGG + Intergenic
1032465097 7:132139210-132139232 ATCAAAGAGCAGAGGGGAGAGGG + Intronic
1032530511 7:132615854-132615876 GGGAGAGAGGAGAGGGGAGAGGG - Intronic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1032957634 7:136989932-136989954 CTGGGAGAGGTGAAGGGAGGTGG - Intronic
1032991951 7:137403525-137403547 AGGGCAGAGCAGAGGGGAGAGGG + Intronic
1033223381 7:139543275-139543297 CTGAGAGAGCAGACCTGAGAGGG - Intronic
1034226629 7:149489806-149489828 GTGGCAGAGTAGAGGGGACAAGG + Intronic
1034348532 7:150401939-150401961 GGTGGTGAGCAGAGGGGAGAAGG - Intronic
1034471798 7:151258709-151258731 AGGTGAGAGCAGAGGGGACAGGG - Intronic
1034540657 7:151756032-151756054 ATGGGAGAGGAGGCGGGAGAGGG - Intronic
1034937735 7:155210568-155210590 CTGGGAGCACAGTGGGGAGGAGG - Intergenic
1034981679 7:155482998-155483020 CTGGGAGTGCAGGGGGCACATGG + Intronic
1034990136 7:155542868-155542890 CTGGGAGGGCAGTGTGGACAGGG - Intergenic
1035056692 7:156040644-156040666 GAGGGAGTGCAGGGGGGAGAAGG - Intergenic
1035174023 7:157037726-157037748 TGGGGAGGGGAGAGGGGAGAGGG + Intergenic
1035237614 7:157509017-157509039 CAGGGAGAGCGAAGGGGAGAGGG + Intergenic
1035282774 7:157787857-157787879 CTGGGGGTGCAGAGGTGTGAGGG - Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035662596 8:1359248-1359270 CAGGGAGGGCAGCGAGGAGAAGG - Intergenic
1035795636 8:2354149-2354171 CTGGGACAGCAGAGGCTAGATGG + Intergenic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1036225173 8:6951773-6951795 CTGGGAGAGCAGAGAAGGAAAGG - Intergenic
1036486319 8:9182654-9182676 CAGGGAGAGCAGAGGTGTCAGGG - Intergenic
1036550979 8:9814733-9814755 AGGGGAGAGGAGAGGGGAGAGGG - Intergenic
1036649487 8:10633274-10633296 GTGGGAGATCAGAGAGTAGAGGG - Intronic
1036723431 8:11200034-11200056 CTGGGAGTGCAGGAGGGGGAAGG + Intronic
1036865108 8:12389604-12389626 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1037587973 8:20290992-20291014 GTGGAGGAGCTGAGGGGAGAAGG - Intronic
1037824719 8:22154515-22154537 ATGGGAAAGCAGAAGGGAGGGGG - Intronic
1037886550 8:22599118-22599140 GGAGGAGAGGAGAGGGGAGAGGG - Intronic
1037886566 8:22599162-22599184 GAGGGAGGGGAGAGGGGAGAGGG - Intronic
1037942540 8:22963202-22963224 ATGGGAAAGAAGAGGGGAAAGGG + Intronic
1037947990 8:23001085-23001107 CTGGGAGAGCGGTGGGCAGGAGG + Intronic
1037950741 8:23017515-23017537 GCGGAAGAGCAGAGGGGTGAAGG - Exonic
1038048442 8:23787079-23787101 GTGAGAGGGCAGAGGGGAAAAGG + Intergenic
1038073138 8:24040291-24040313 CTGGGAGATGAGAGGATAGAAGG - Intergenic
1038125789 8:24671408-24671430 CTGAGAAAGCAGATGTGAGAAGG + Intergenic
1038147471 8:24912722-24912744 CTCGGAGAGAAGAGGGGGAAGGG + Intergenic
1038228411 8:25678251-25678273 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1038428432 8:27480631-27480653 CTTGGAGAGCAGGGAGAAGAGGG + Intergenic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039062394 8:33581954-33581976 CTGGGAGAGGAGTGGGGATTGGG + Intergenic
1039182746 8:34884732-34884754 GAGGGAGAGCAAGGGGGAGATGG + Intergenic
1039280755 8:35981293-35981315 TTGGGAGAACAGAGCTGAGATGG + Intergenic
1039428140 8:37503841-37503863 CTGGGGGTGCAGAGAGGATAGGG - Intergenic
1040555474 8:48474104-48474126 CTGGGGGCGCAGAGAGGAAAGGG + Intergenic
1040688904 8:49910726-49910748 GTGGGAGACCAGAGGGAAAATGG + Intronic
1040855982 8:51948302-51948324 CTGGGAGGGCAGAAGCAAGATGG + Intergenic
1041149581 8:54917297-54917319 CTGGGAGAGCTGTGGGGAAAAGG - Intergenic
1041534271 8:58908385-58908407 TTGGGAGATGAGAGGTGAGAAGG - Intronic
1042266079 8:66910378-66910400 CTGTGAAAGCAGTGGGGAGAGGG + Intronic
1042737610 8:72005920-72005942 CTGGGAGATCAGAGCTGAAAAGG - Intronic
1042755156 8:72202482-72202504 CTGTGAGAGCAGATGGGTGGGGG - Intergenic
1042957604 8:74268351-74268373 CTGGGAGAAAAGAAGGGAAAAGG + Intronic
1043660961 8:82739932-82739954 ATCAGAGAGCAGAGGGAAGATGG + Intergenic
1044365163 8:91336505-91336527 TTGGGGGAGGAGGGGGGAGATGG - Intronic
1044879789 8:96712222-96712244 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
1044933137 8:97269387-97269409 CTGGGAGACCTGGGGGGAAAAGG + Intergenic
1045049165 8:98307107-98307129 AGAGGAGAGGAGAGGGGAGAGGG - Intergenic
1045105517 8:98888805-98888827 CTGAGAGAGCAGACTGGAAATGG - Intronic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1045191562 8:99889264-99889286 CTGGGAGAGCAAAGAGGAGATGG - Intronic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1045362107 8:101442321-101442343 CTTGGAGCTCAGAGGAGAGAAGG + Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047521815 8:125600757-125600779 CTTGGGGAGCAGAAGGGAGGAGG + Intergenic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1047732186 8:127736816-127736838 ATGGGAGAGGAGAAGGCAGAGGG + Intronic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1048029271 8:130615712-130615734 CAGGGACAGCAGAGCTGAGAGGG - Intergenic
1048066537 8:130975129-130975151 GTGGGAGAGGTGAGAGGAGAAGG + Intronic
1048300862 8:133250189-133250211 CTGGGGGTGCAGACGTGAGAGGG - Intronic
1048348541 8:133596977-133596999 CAGGGGGAGCAGAGGGTAAACGG - Intergenic
1048437383 8:134431223-134431245 CTGGGAGAGATGAAGGTAGACGG + Intergenic
1048445134 8:134487653-134487675 CTGGAAGTTCAGAGGCGAGAGGG - Intronic
1048452328 8:134544258-134544280 CTGGGGGAGCATAGGTGAGCGGG - Intronic
1048574453 8:135679907-135679929 AGGGTAGAGCAGAGGGGAGAAGG - Intergenic
1049018261 8:139936735-139936757 CAGGGAGAGAATAGGGGAGTGGG + Intronic
1049083116 8:140457876-140457898 GAGGGAGAGAAGAGGGGACAGGG + Intronic
1049300120 8:141865255-141865277 CTGGGAGAGCCGATGGCAGCTGG + Intergenic
1049452636 8:142670196-142670218 CAGGGAGGGGAGAGGGGAAACGG + Intronic
1049652923 8:143783224-143783246 CTGGGAGAGCATGGGGCAGTGGG - Intergenic
1049712411 8:144071256-144071278 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1050151274 9:2621770-2621792 CGGGGTGAGCAGCGGGGAGGGGG - Intergenic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1050985453 9:12076601-12076623 AGGGGAGAGGAGAGTGGAGAGGG - Intergenic
1051240451 9:15050082-15050104 AGGGGAGAGGAGAGGGGAGGCGG + Intergenic
1051418712 9:16870454-16870476 CTGGGAGCGCAGCGGGGATCAGG + Intronic
1051646963 9:19278857-19278879 CTGGGGGGGCAGAGTGGAGGGGG - Intronic
1051664509 9:19456173-19456195 CTGGCAGAGGTGAGGGGACAAGG + Intergenic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1052832624 9:33228574-33228596 CTGGGAGGGAAGAGGAGAGACGG + Intronic
1052864678 9:33457731-33457753 CTGGGAGAATAGAGGAGAGCTGG + Intergenic
1052951913 9:34219941-34219963 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1052951973 9:34220060-34220082 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1052979003 9:34433864-34433886 CGGGGAGGGCAGAGGAGAGTCGG - Intronic
1053105685 9:35406046-35406068 TTGGGAGAGGAGCGGGGAGGAGG - Intergenic
1053285117 9:36845190-36845212 CTGGGAGACCCCAGGGGATATGG - Intronic
1053484748 9:38443259-38443281 CTGGGAGAGGAGAAGTGGGAGGG + Intergenic
1055421522 9:76148371-76148393 ATGGGAGAGGAAAGGAGAGAGGG - Intronic
1055673161 9:78627410-78627432 CTGCAAGAGCAGAGGGGAGAGGG - Intergenic
1055786960 9:79881541-79881563 AGGGGAGGGAAGAGGGGAGAAGG - Intergenic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1056408800 9:86303970-86303992 CTGGGAGTACAGAGGGAATAGGG + Intronic
1056798595 9:89675739-89675761 CTGCAAGGGCAGAGGGGACAGGG + Intergenic
1057079528 9:92162217-92162239 CTGGAAGAGAAGAAGGGAGAGGG + Intergenic
1057239812 9:93398869-93398891 GTGGTGGAGCAGAGGAGAGAAGG + Intergenic
1057500377 9:95593045-95593067 CTGGCAGAGGTGAGGTGAGAGGG + Intergenic
1057929457 9:99180928-99180950 ATGAGAGATCAGAGGGCAGAGGG - Intergenic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1058333474 9:103795125-103795147 TTGCCAGAGCTGAGGGGAGAGGG - Intergenic
1058959341 9:109978158-109978180 CTGAGGTGGCAGAGGGGAGATGG + Intronic
1059171643 9:112130424-112130446 AGGAGAGAGGAGAGGGGAGAAGG + Intronic
1059215005 9:112553167-112553189 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1059642812 9:116234301-116234323 TTGGGTGAGGAGCGGGGAGAAGG - Intronic
1060030434 9:120210345-120210367 CTGGCAGAGCCGAGGTGAGGTGG - Intergenic
1060183213 9:121547920-121547942 ATGGGAGTGGAGAAGGGAGATGG - Intergenic
1060218356 9:121751819-121751841 ATGGGAGGGCAGAGGGGAATGGG - Intronic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1060497917 9:124131405-124131427 ATGGGGAAGCAGAGGGGAGCGGG + Intergenic
1060509570 9:124222253-124222275 CTGGAAGGGCAGATGGGAGTGGG - Intergenic
1060526435 9:124323768-124323790 CTGAGAGAGAAGAGGAGACATGG + Intronic
1060686873 9:125622808-125622830 CGGAGAGGGGAGAGGGGAGAGGG - Intronic
1061201537 9:129141031-129141053 CTGGGAGAGAAGAGGAGGGGAGG + Intronic
1061246094 9:129401869-129401891 CAGGGAGAGCAGAGCTGTGAAGG - Intergenic
1061250198 9:129421950-129421972 CAGGGAGAGCAGTGGGGACAAGG - Intergenic
1061261223 9:129482162-129482184 CTGGGAGGGGAGAGGGGGGCGGG - Intergenic
1061275742 9:129568750-129568772 CTGGGAAAGGAGAGGGCAGCGGG + Intergenic
1061592571 9:131607425-131607447 CTGGGATGGCAGTGGGGTGAAGG + Intronic
1061807538 9:133144701-133144723 CTAGGGGAGCAGCGGGGAGTCGG - Intronic
1061855100 9:133437726-133437748 CTGGGAGGGCAGAGTGAAAAAGG - Intronic
1061885423 9:133588847-133588869 TTGGTAGAGGAGATGGGAGAAGG + Intergenic
1061887429 9:133598939-133598961 CAGGGAGAGCCCAGGGCAGATGG + Intergenic
1062052869 9:134456496-134456518 AAGGGAGAGCCGCGGGGAGAAGG + Intergenic
1062139107 9:134945666-134945688 CCTGGAGAGCGGAGGGCAGAGGG + Intergenic
1062168772 9:135122628-135122650 CTAGGAGAGCAGATGGGAAGTGG - Intergenic
1062241980 9:135545795-135545817 CTGGGAGGGCTCAGGGGTGAGGG + Intergenic
1062271889 9:135713651-135713673 GCAGGAGAGCAGAGGGGGGATGG - Intronic
1062321123 9:135990923-135990945 AGGGGAGAGGAGAGGAGAGATGG - Intergenic
1062344581 9:136109039-136109061 CGGGGAGGGCAGAGGGGTCAGGG - Intergenic
1062370453 9:136236128-136236150 CTGGGACAGCTGAGTGGAGGTGG - Intronic
1062451106 9:136616188-136616210 CCGAGTGGGCAGAGGGGAGACGG - Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062488018 9:136790925-136790947 CTGCTAGAGCGCAGGGGAGAGGG - Intergenic
1062552598 9:137096725-137096747 CTGGTCGAGCAGAGAGCAGAGGG + Intronic
1062636844 9:137495952-137495974 CTGGCAGAGCTGAGGCGAGGCGG + Intronic
1062731358 9:138111888-138111910 CAAGGAGAGCAGAGCGGGGAAGG - Intronic
1203782453 EBV:108185-108207 CTGGGAATGGAGAGGGGAGTGGG + Intergenic
1203472526 Un_GL000220v1:122480-122502 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1185459548 X:328353-328375 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459565 X:328381-328403 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459576 X:328401-328423 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459587 X:328421-328443 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459638 X:328525-328547 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459655 X:328553-328575 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459666 X:328573-328595 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459677 X:328593-328615 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459708 X:328655-328677 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459725 X:328683-328705 CGGGGAGAGGGGAGGGGGGATGG - Intergenic
1185459922 X:329063-329085 CGGGGAGAGAGGAGGGGGGACGG - Intergenic
1185459931 X:329083-329105 CGGGGAGAGAGGAGGGGGGACGG - Intergenic
1185490942 X:516579-516601 CAGTGAGAGGAGGGGGGAGAAGG - Intergenic
1185623751 X:1468779-1468801 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1185623784 X:1468851-1468873 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1185623795 X:1468875-1468897 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1185623809 X:1468909-1468931 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1185623842 X:1468992-1469014 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1185623853 X:1469016-1469038 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1185966824 X:4614916-4614938 CAGAGAGAGGAGGGGGGAGAGGG + Intergenic
1186363750 X:8870410-8870432 AAGGAAGAGAAGAGGGGAGAAGG + Intergenic
1186689708 X:11962329-11962351 CAGGAAGAGCAGAAGGGAAAAGG + Intergenic
1186843653 X:13509670-13509692 CTTGCAGAGTAAAGGGGAGATGG - Intergenic
1187043068 X:15617174-15617196 CTGGGAGAGATGAGGAGATATGG + Intergenic
1187168533 X:16827915-16827937 CTGGAAGAGGAGAGAAGAGAAGG + Intronic
1187426480 X:19181830-19181852 CTGAAAGAGCAGAAGGGAGATGG + Intergenic
1187449097 X:19381342-19381364 ATGGGAGAGCAGCCCGGAGAGGG + Intronic
1187571025 X:20502301-20502323 CTGGGTGGGCTGAGGGGAGGTGG - Intergenic
1187670916 X:21665144-21665166 CTGAAAGACCAGAGGGGTGAAGG - Intergenic
1188085287 X:25895507-25895529 CAGGGAAAGGAAAGGGGAGAAGG + Intergenic
1188368153 X:29335273-29335295 CGGAGAGGGGAGAGGGGAGAGGG + Intronic
1188976864 X:36686158-36686180 CAGACAGAGCAGAGTGGAGATGG - Intergenic
1189217737 X:39341623-39341645 CTGGGTGGGCAGAAGGGATATGG - Intergenic
1189235099 X:39480871-39480893 AGGGGAGTGGAGAGGGGAGATGG + Intergenic
1189325581 X:40109083-40109105 CTGGGAGGGCGGCGGGGAGGAGG + Intronic
1189422297 X:40866907-40866929 CTTGTAGATCAGAGGGGTGATGG + Intergenic
1189843897 X:45114164-45114186 GGGGGAGGGGAGAGGGGAGAGGG + Intergenic
1189931574 X:46017558-46017580 TTGGGAGAGCAGTAGGGATATGG - Intergenic
1190298023 X:49039963-49039985 CTGAGAGAGGGGAGGGGAGGGGG - Intronic
1190320012 X:49174465-49174487 CTGAGAGGGCAGAGGGAAAAAGG + Intronic
1190550025 X:51570417-51570439 CTGTTAGAGCAGAGGAAAGATGG + Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192343475 X:70282326-70282348 CTGGGAGAGCAGAGCGGTGTGGG + Exonic
1192429425 X:71102276-71102298 ATGGGAGGGGAAAGGGGAGAGGG + Exonic
1192429558 X:71103062-71103084 CTGGGAGGGGAGAGAAGAGAAGG + Exonic
1192484651 X:71514506-71514528 CTGAGGGAGCAGAAAGGAGAGGG + Intronic
1192928609 X:75781928-75781950 CTGGGGGAGCGGCAGGGAGAAGG - Intergenic
1193359924 X:80569976-80569998 CTGGGAGCACAGAGGGGAGAGGG - Intergenic
1193841986 X:86418155-86418177 CTGTGAAAGCAGCTGGGAGAAGG - Intronic
1195010371 X:100727854-100727876 CAGGGAGTGCTGAGGGAAGAGGG + Intronic
1195574933 X:106439009-106439031 TGGGGAGGGAAGAGGGGAGAAGG - Intergenic
1195758449 X:108221997-108222019 ATTGGAGAGGAGAGGAGAGAGGG - Intronic
1195803561 X:108737052-108737074 GTGAGAGGGGAGAGGGGAGAGGG + Intergenic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1196237463 X:113299815-113299837 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1196237469 X:113299827-113299849 AGGGGAGAGAGGAGGGGAGAGGG - Intergenic
1196237479 X:113299851-113299873 GAGGGAGAGGGGAGGGGAGAGGG - Intergenic
1196237522 X:113299933-113299955 AGGGGAGAGGAGAGGGGAGGGGG - Intergenic
1196322677 X:114360707-114360729 GTGGGAAAGTGGAGGGGAGATGG + Intergenic
1197712765 X:129683800-129683822 CTACGAGAGCAGAGAGGAAATGG + Intergenic
1197727058 X:129783332-129783354 GTGGGAGTGCAGAGGGGGAAGGG - Intronic
1197884087 X:131200114-131200136 TTGTGAAAGGAGAGGGGAGAAGG + Intergenic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1198129352 X:133678308-133678330 TTGAGAGAGCAAAGGGAAGAGGG + Intronic
1198228640 X:134669527-134669549 GTGGGGGAGCACAGAGGAGAAGG + Intronic
1198310975 X:135425502-135425524 CTGGGAGAGAAGAGGTGGGGAGG - Intergenic
1199807255 X:151312641-151312663 CTGGCAGAGCAGAGGGGTGTAGG - Intergenic
1200162096 X:154014907-154014929 CTGAGAGGGCAGAGCCGAGAAGG + Intronic
1200945070 Y:8826804-8826826 CTGGGATGATAGAGGGGAGAGGG + Intergenic
1201074769 Y:10178798-10178820 CTGGGGGAGAAGTGGGGACAAGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1202048878 Y:20760638-20760660 GTGGGAGAGGAGAGTGGAGAAGG + Intronic
1202163648 Y:21963260-21963282 ATGAGAGAGATGAGGGGAGAGGG - Intergenic
1202227708 Y:22623105-22623127 ATGAGAGAGATGAGGGGAGAGGG + Intergenic
1202315449 Y:23573073-23573095 ATGAGAGAGATGAGGGGAGAGGG - Intergenic
1202379265 Y:24261512-24261534 AGAGGAGAGGAGAGGGGAGAGGG - Intergenic
1202491517 Y:25408609-25408631 AGAGGAGAGGAGAGGGGAGAGGG + Intergenic
1202555352 Y:26097524-26097546 ATGAGAGAGATGAGGGGAGAGGG + Intergenic