ID: 1062465364

View in Genome Browser
Species Human (GRCh38)
Location 9:136678438-136678460
Sequence GTGATGGGGTGCCCTATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062465364_1062465371 -9 Left 1062465364 9:136678438-136678460 CCCCAGATAGGGCACCCCATCAC No data
Right 1062465371 9:136678452-136678474 CCCCATCACAGGGCAGCCGGCGG No data
1062465364_1062465380 11 Left 1062465364 9:136678438-136678460 CCCCAGATAGGGCACCCCATCAC No data
Right 1062465380 9:136678472-136678494 CGGGGATGGAGCCAGGAGGACGG No data
1062465364_1062465375 -7 Left 1062465364 9:136678438-136678460 CCCCAGATAGGGCACCCCATCAC No data
Right 1062465375 9:136678454-136678476 CCATCACAGGGCAGCCGGCGGGG No data
1062465364_1062465379 7 Left 1062465364 9:136678438-136678460 CCCCAGATAGGGCACCCCATCAC No data
Right 1062465379 9:136678468-136678490 CCGGCGGGGATGGAGCCAGGAGG No data
1062465364_1062465373 -8 Left 1062465364 9:136678438-136678460 CCCCAGATAGGGCACCCCATCAC No data
Right 1062465373 9:136678453-136678475 CCCATCACAGGGCAGCCGGCGGG No data
1062465364_1062465376 -3 Left 1062465364 9:136678438-136678460 CCCCAGATAGGGCACCCCATCAC No data
Right 1062465376 9:136678458-136678480 CACAGGGCAGCCGGCGGGGATGG No data
1062465364_1062465377 4 Left 1062465364 9:136678438-136678460 CCCCAGATAGGGCACCCCATCAC No data
Right 1062465377 9:136678465-136678487 CAGCCGGCGGGGATGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062465364 Original CRISPR GTGATGGGGTGCCCTATCTG GGG (reversed) Intronic