ID: 1062467067

View in Genome Browser
Species Human (GRCh38)
Location 9:136686225-136686247
Sequence GCCCCTGGAACCACGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062467055_1062467067 29 Left 1062467055 9:136686173-136686195 CCAGGGCTGGCAAGGACAGCGAG 0: 1
1: 0
2: 5
3: 17
4: 220
Right 1062467067 9:136686225-136686247 GCCCCTGGAACCACGGGGAAGGG No data
1062467054_1062467067 30 Left 1062467054 9:136686172-136686194 CCCAGGGCTGGCAAGGACAGCGA 0: 1
1: 0
2: 2
3: 13
4: 237
Right 1062467067 9:136686225-136686247 GCCCCTGGAACCACGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062467067 Original CRISPR GCCCCTGGAACCACGGGGAA GGG Intronic
No off target data available for this crispr