ID: 1062467226

View in Genome Browser
Species Human (GRCh38)
Location 9:136686749-136686771
Sequence GCGCCCTGATCAATAGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062467222_1062467226 -10 Left 1062467222 9:136686736-136686758 CCCACGCCGTCGTGCGCCCTGAT 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1062467226 9:136686749-136686771 GCGCCCTGATCAATAGCCCTGGG No data
1062467220_1062467226 -8 Left 1062467220 9:136686734-136686756 CCCCCACGCCGTCGTGCGCCCTG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1062467226 9:136686749-136686771 GCGCCCTGATCAATAGCCCTGGG No data
1062467219_1062467226 2 Left 1062467219 9:136686724-136686746 CCGAGGGGTGCCCCCACGCCGTC 0: 1
1: 0
2: 1
3: 5
4: 104
Right 1062467226 9:136686749-136686771 GCGCCCTGATCAATAGCCCTGGG No data
1062467221_1062467226 -9 Left 1062467221 9:136686735-136686757 CCCCACGCCGTCGTGCGCCCTGA 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1062467226 9:136686749-136686771 GCGCCCTGATCAATAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062467226 Original CRISPR GCGCCCTGATCAATAGCCCT GGG Intronic
No off target data available for this crispr