ID: 1062467508

View in Genome Browser
Species Human (GRCh38)
Location 9:136687647-136687669
Sequence CTGTGGGGAGGGAGCGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062467508_1062467522 26 Left 1062467508 9:136687647-136687669 CCCTCCACGCTCCCTCCCCACAG No data
Right 1062467522 9:136687696-136687718 GCGCTCTGCTCCCACCCTCCCGG No data
1062467508_1062467517 -2 Left 1062467508 9:136687647-136687669 CCCTCCACGCTCCCTCCCCACAG No data
Right 1062467517 9:136687668-136687690 AGCCTTCTGCCAGGTTACCGAGG No data
1062467508_1062467519 4 Left 1062467508 9:136687647-136687669 CCCTCCACGCTCCCTCCCCACAG No data
Right 1062467519 9:136687674-136687696 CTGCCAGGTTACCGAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062467508 Original CRISPR CTGTGGGGAGGGAGCGTGGA GGG (reversed) Intergenic
No off target data available for this crispr