ID: 1062471003

View in Genome Browser
Species Human (GRCh38)
Location 9:136704432-136704454
Sequence TGCCACGATGATGTTTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062471003_1062471012 24 Left 1062471003 9:136704432-136704454 CCTCAGGAAACATCATCGTGGCA No data
Right 1062471012 9:136704479-136704501 TCCTACGTGGCTGGAGCAGGAGG 0: 4
1: 88
2: 272
3: 498
4: 900
1062471003_1062471014 30 Left 1062471003 9:136704432-136704454 CCTCAGGAAACATCATCGTGGCA No data
Right 1062471014 9:136704485-136704507 GTGGCTGGAGCAGGAGGAAGAGG No data
1062471003_1062471011 21 Left 1062471003 9:136704432-136704454 CCTCAGGAAACATCATCGTGGCA No data
Right 1062471011 9:136704476-136704498 GTGTCCTACGTGGCTGGAGCAGG No data
1062471003_1062471009 11 Left 1062471003 9:136704432-136704454 CCTCAGGAAACATCATCGTGGCA No data
Right 1062471009 9:136704466-136704488 GGACACAGGTGTGTCCTACGTGG No data
1062471003_1062471007 -10 Left 1062471003 9:136704432-136704454 CCTCAGGAAACATCATCGTGGCA No data
Right 1062471007 9:136704445-136704467 CATCGTGGCAGAAGGTGAAGGGG No data
1062471003_1062471008 -3 Left 1062471003 9:136704432-136704454 CCTCAGGAAACATCATCGTGGCA No data
Right 1062471008 9:136704452-136704474 GCAGAAGGTGAAGGGGACACAGG No data
1062471003_1062471010 15 Left 1062471003 9:136704432-136704454 CCTCAGGAAACATCATCGTGGCA No data
Right 1062471010 9:136704470-136704492 ACAGGTGTGTCCTACGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062471003 Original CRISPR TGCCACGATGATGTTTCCTG AGG (reversed) Intergenic
No off target data available for this crispr