ID: 1062474097

View in Genome Browser
Species Human (GRCh38)
Location 9:136719071-136719093
Sequence CTCCAGGGGTGCATCTGATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 97}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062474097_1062474115 24 Left 1062474097 9:136719071-136719093 CCCGATCAGATGCACCCCTGGAG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1062474115 9:136719118-136719140 AGGGGCCGGACCTCCGGGCCGGG No data
1062474097_1062474112 18 Left 1062474097 9:136719071-136719093 CCCGATCAGATGCACCCCTGGAG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1062474112 9:136719112-136719134 AGGTGGAGGGGCCGGACCTCCGG No data
1062474097_1062474107 4 Left 1062474097 9:136719071-136719093 CCCGATCAGATGCACCCCTGGAG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1062474107 9:136719098-136719120 TAGAAGGACCAAGGAGGTGGAGG No data
1062474097_1062474114 23 Left 1062474097 9:136719071-136719093 CCCGATCAGATGCACCCCTGGAG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1062474114 9:136719117-136719139 GAGGGGCCGGACCTCCGGGCCGG No data
1062474097_1062474110 10 Left 1062474097 9:136719071-136719093 CCCGATCAGATGCACCCCTGGAG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1062474110 9:136719104-136719126 GACCAAGGAGGTGGAGGGGCCGG No data
1062474097_1062474109 6 Left 1062474097 9:136719071-136719093 CCCGATCAGATGCACCCCTGGAG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1062474109 9:136719100-136719122 GAAGGACCAAGGAGGTGGAGGGG No data
1062474097_1062474108 5 Left 1062474097 9:136719071-136719093 CCCGATCAGATGCACCCCTGGAG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1062474108 9:136719099-136719121 AGAAGGACCAAGGAGGTGGAGGG No data
1062474097_1062474113 19 Left 1062474097 9:136719071-136719093 CCCGATCAGATGCACCCCTGGAG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1062474113 9:136719113-136719135 GGTGGAGGGGCCGGACCTCCGGG No data
1062474097_1062474105 1 Left 1062474097 9:136719071-136719093 CCCGATCAGATGCACCCCTGGAG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1062474105 9:136719095-136719117 TCCTAGAAGGACCAAGGAGGTGG No data
1062474097_1062474103 -5 Left 1062474097 9:136719071-136719093 CCCGATCAGATGCACCCCTGGAG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1062474103 9:136719089-136719111 TGGAGCTCCTAGAAGGACCAAGG No data
1062474097_1062474104 -2 Left 1062474097 9:136719071-136719093 CCCGATCAGATGCACCCCTGGAG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1062474104 9:136719092-136719114 AGCTCCTAGAAGGACCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062474097 Original CRISPR CTCCAGGGGTGCATCTGATC GGG (reversed) Intronic
904885202 1:33732474-33732496 CACCAGGGGTGCATGTGCACAGG + Intronic
916125701 1:161569062-161569084 CTCAAAGGGTGCATCAGAACTGG - Intergenic
916135617 1:161650893-161650915 CTCAAAGGGTGCATCAGAACTGG - Intronic
922593825 1:226798689-226798711 CTCCCAGTGTGCAGCTGATCAGG - Intergenic
1071000298 10:80824053-80824075 TTCCAAGGGTGCATCTGAACAGG - Intergenic
1073667243 10:105547246-105547268 CTCCAGGGGTACCTCTCATTTGG + Intergenic
1075844885 10:125537154-125537176 ATCCACGGGTGCACCTCATCGGG - Intergenic
1076679647 10:132165145-132165167 GTCAACGGGTGCTTCTGATCCGG - Intronic
1077408182 11:2391880-2391902 CTCCAAGGGTGCATCTCTACTGG + Intronic
1077997319 11:7465120-7465142 CTCCAGGGTAGCAGCTGATCTGG + Intronic
1078098744 11:8316374-8316396 CTCCAGTGGTTTAGCTGATCTGG - Intergenic
1089324502 11:117648005-117648027 CACCAGGGCTGCTTCTGAGCTGG - Intronic
1093005625 12:14047789-14047811 CTCCCTGTGTGCATGTGATCAGG - Intergenic
1096693601 12:53335494-53335516 TTCCAGGGGTCCTTCTGATGAGG - Intronic
1098408410 12:70152078-70152100 ATCCAGGGGTGCATTTCAGCTGG - Intergenic
1102589905 12:113949242-113949264 CTCCAGGGCTGAAGCTGAACTGG - Intronic
1104636594 12:130441528-130441550 GTCCAGGGGTGCATGTGACACGG + Intronic
1104907119 12:132219587-132219609 CCCCAGGGGTCCATCAGAGCTGG - Intronic
1112370441 13:98788550-98788572 GTCCAGGGAGGCCTCTGATCAGG - Intergenic
1121961533 14:98264686-98264708 CTGCATGGCTGCATCTGTTCTGG - Intergenic
1122440956 14:101731519-101731541 CTCCAGGGCTCCATCTGGCCTGG - Intronic
1122783252 14:104152614-104152636 CATCAAGGGTGCATCTGATGTGG - Intronic
1124821060 15:33045632-33045654 GTCCAGGATTGAATCTGATCTGG + Intronic
1130754381 15:86747078-86747100 GTCCTGGGGTGCATATGCTCGGG - Intronic
1132307334 15:100825895-100825917 CTCCAAGAGTGCCTGTGATCAGG - Intergenic
1133678514 16:8098520-8098542 CTGCAGGGGTGCATTTGAGATGG - Intergenic
1134212519 16:12289589-12289611 TTCCAGTTGTGCCTCTGATCTGG + Intronic
1140410893 16:74739760-74739782 CTCCAGGGGTGTCTGGGATCTGG + Intronic
1148076108 17:44936031-44936053 CTCCAGGGCTACAACTGCTCAGG - Exonic
1150104693 17:62453763-62453785 CTCCAGGTGTGAAGCTGCTCAGG + Intergenic
1157918968 18:51696748-51696770 CTTCAGGGGTACATGTCATCTGG - Intergenic
1160508962 18:79442701-79442723 CTCCTGGGGAGCTTCTGCTCCGG + Intronic
1168654827 19:58119424-58119446 CTTCATGGGTGCACCTGTTCAGG + Intergenic
1168684161 19:58337888-58337910 CTGCAGGGGTGCATGTGCTCAGG + Intronic
928022761 2:27716431-27716453 CTCCAGGGCTGCAGCTGCTCGGG - Intergenic
931643285 2:64399927-64399949 CTCCAGGCATGCATCTGAGATGG + Intergenic
944425844 2:199582258-199582280 CTCCTGGGGTGCCTCTGACTGGG + Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
1170630745 20:18062668-18062690 CTCCAGGGATGCCACTGAGCAGG - Intergenic
1170986366 20:21263138-21263160 TTACAGGGGTGCATATGATTGGG + Intergenic
1173187651 20:40853393-40853415 CTCCTGTGTTGCAGCTGATCTGG - Intergenic
1176157573 20:63629603-63629625 CTCCAGGGGAGAAGCTGTTCTGG + Intergenic
1178776869 21:35560070-35560092 CTCCTGGAGTGCTTCTGAACGGG + Intronic
1179215289 21:39362176-39362198 CTCCAGGGGTGGGCCTGATTTGG - Intergenic
1179904714 21:44416478-44416500 CTCCAGGGGTGCATGTGGAAGGG - Intronic
1180021824 21:45133413-45133435 CTTCAGGGGTTTACCTGATCAGG + Intronic
949963055 3:9330330-9330352 GTCCAGGGATGGATTTGATCTGG - Intronic
953460688 3:43079465-43079487 CTCCAGGGGTACAAATGTTCAGG + Exonic
954176848 3:48851565-48851587 CTCCAGTGGTGCAGCTGGACAGG - Intergenic
961504916 3:127363464-127363486 CACCATGGGTGCCTCTGATGGGG + Intergenic
962385201 3:134927205-134927227 CTGCAGGGGTGGTTCTAATCGGG + Intronic
962564555 3:136644426-136644448 CTCCAGGGATGCCTCTGATCAGG + Intronic
966851913 3:184170040-184170062 CTCCAGTGGCGCCTCTGACCAGG + Exonic
970445479 4:16120448-16120470 ATCGAGGGGAGCATTTGATCAGG - Intergenic
971494686 4:27251246-27251268 CTCCAGGGTTGAATCAGAGCTGG - Intergenic
974786443 4:66624450-66624472 CTTCAGGGGTGCATCAGAAAGGG - Intergenic
983365809 4:166786997-166787019 TTCAAGAGGTGCATCTGAGCTGG - Intronic
983900114 4:173124575-173124597 CTCCAGGGGTTTATCTATTCAGG + Intergenic
984172454 4:176376844-176376866 TTCCAGGGGTGCATCTGGTTAGG - Intergenic
984730761 4:183066020-183066042 CTCCAGGGGAGGATCTGTCCTGG - Intergenic
985527602 5:415111-415133 CTCCAGGTGCGCATCTCACCTGG - Intronic
987311112 5:16681933-16681955 ATCCAGTGGTGCATCTCCTCCGG + Exonic
988513788 5:31888030-31888052 TTCCAGGGGTGCAGCTGTTTTGG + Intronic
993379340 5:87188272-87188294 CTCCTGGGATCCATCTGATATGG - Intergenic
995244589 5:109921695-109921717 GCTCAGGGGTGAATCTGATCAGG + Intergenic
996320624 5:122211337-122211359 CTTCAGGGTTCTATCTGATCAGG - Intergenic
996754119 5:126918100-126918122 CACCACGGGTGCAGCTGAGCTGG + Exonic
996783063 5:127209492-127209514 CTCCAGGGCTGCATCTGGTAAGG + Intergenic
997882505 5:137602987-137603009 CTCCAGGGCTGCTTCTGGGCTGG + Intergenic
1002699105 5:181109960-181109982 ATCGAGGGGTGCGTCTGGTCTGG + Intergenic
1006638416 6:35476027-35476049 CTCCAGGGGTGGGTCTGAGAAGG + Exonic
1006781844 6:36637456-36637478 CTCCCTGGGAGCATCTGATTAGG + Intergenic
1007705767 6:43790321-43790343 CTCCAGGGGGGTATCTGGGCAGG - Intergenic
1007861534 6:44914858-44914880 CACCAGGTGTGGATCAGATCAGG + Intronic
1008653619 6:53588747-53588769 CTCCAGGGGGCAATCTGACCTGG + Intronic
1009458343 6:63883199-63883221 CTCCAGGGCTGGATATGATCTGG + Intronic
1015570787 6:134619333-134619355 CTGCAGGCGTGCATCTGATGGGG + Intergenic
1018145015 6:160877600-160877622 CTCCAGGAGTGCACCTGGTGAGG + Intergenic
1018790183 6:167142319-167142341 TTCCAGGGGTGCCTCTGCCCTGG + Intergenic
1020111191 7:5448646-5448668 GTCCAGGGGTGGATCTGGCCTGG - Intronic
1022476869 7:30716724-30716746 TTCCAGGGCTGCCTCTGACCTGG + Intronic
1023267083 7:38417935-38417957 CTCCAAGGCTGAATCTGAACAGG - Exonic
1027124249 7:75544784-75544806 CATCAGGGATGCAGCTGATCTGG - Exonic
1028456255 7:91041073-91041095 CTCCAGGTGTGCCTCTGCCCTGG - Intronic
1030028928 7:105351266-105351288 GTCAAGGGGTGCATCTAATGAGG - Intronic
1031923480 7:127618025-127618047 CTCCAGGGGTGGTGATGATCTGG + Intergenic
1032033865 7:128506977-128506999 CTCCAGGTGTGAAGCTGCTCAGG + Intergenic
1033362408 7:140647016-140647038 CTCCTGGATTGCATCTGATTGGG - Intronic
1033536800 7:142320295-142320317 CTGCAGGTGTGCCTCTCATCAGG + Intergenic
1034877644 7:154739420-154739442 CGCCAGGGGTCCATCTGGTTGGG + Intronic
1037764661 8:21765046-21765068 CTTCTGGGCTGCATCTGACCAGG + Intronic
1038407967 8:27335974-27335996 CTCCTGGGGTGCAGGTCATCTGG + Intronic
1038452990 8:27651655-27651677 CTGCAGGGGGGTGTCTGATCAGG + Intronic
1043272285 8:78350365-78350387 CACCATGGGTGCAGGTGATCAGG + Intergenic
1043603386 8:81969337-81969359 CTCCAAGGTTCCATGTGATCTGG + Intergenic
1045278962 8:100732457-100732479 CAGCAGGAGTGCATATGATCAGG - Intergenic
1048165949 8:132061630-132061652 CTCAGGGGGTGCTACTGATCTGG - Intronic
1048348932 8:133600172-133600194 CAACAGGGTTCCATCTGATCTGG - Intergenic
1049069236 8:140344323-140344345 CTCCTGGGGTGCATCTTTACTGG - Intronic
1056217650 9:84420093-84420115 CATCAGGGGTGCATCTGCACTGG + Intergenic
1057819453 9:98319791-98319813 CTCCCAGGGGGCATCTCATCTGG - Intronic
1062474097 9:136719071-136719093 CTCCAGGGGTGCATCTGATCGGG - Intronic
1189919817 X:45892424-45892446 CTATTGGGGTGCATCTTATCTGG - Intergenic
1190187020 X:48244102-48244124 CTCCGGTGATGGATCTGATCAGG + Intronic
1190908594 X:54751364-54751386 CTCCAGGGCTGCATGTGAGTGGG - Exonic
1193500936 X:82274511-82274533 CTCCAAGGGACCATCTGATAAGG + Intergenic
1200098161 X:153673763-153673785 CTCCAGGTCTGCACCTGCTCCGG - Intronic