ID: 1062476137

View in Genome Browser
Species Human (GRCh38)
Location 9:136728397-136728419
Sequence GGCCCTGGCTGCTGGCCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062476137_1062476152 26 Left 1062476137 9:136728397-136728419 CCACGGGGCCAGCAGCCAGGGCC No data
Right 1062476152 9:136728446-136728468 GGGCACGCCACGGACACGCGCGG No data
1062476137_1062476142 -1 Left 1062476137 9:136728397-136728419 CCACGGGGCCAGCAGCCAGGGCC No data
Right 1062476142 9:136728419-136728441 CGCGCCGTTTCCGACCCGCCGGG No data
1062476137_1062476149 16 Left 1062476137 9:136728397-136728419 CCACGGGGCCAGCAGCCAGGGCC No data
Right 1062476149 9:136728436-136728458 GCCGGGTGCCGGGCACGCCACGG No data
1062476137_1062476144 5 Left 1062476137 9:136728397-136728419 CCACGGGGCCAGCAGCCAGGGCC No data
Right 1062476144 9:136728425-136728447 GTTTCCGACCCGCCGGGTGCCGG No data
1062476137_1062476145 6 Left 1062476137 9:136728397-136728419 CCACGGGGCCAGCAGCCAGGGCC No data
Right 1062476145 9:136728426-136728448 TTTCCGACCCGCCGGGTGCCGGG No data
1062476137_1062476141 -2 Left 1062476137 9:136728397-136728419 CCACGGGGCCAGCAGCCAGGGCC No data
Right 1062476141 9:136728418-136728440 CCGCGCCGTTTCCGACCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062476137 Original CRISPR GGCCCTGGCTGCTGGCCCCG TGG (reversed) Intergenic