ID: 1062476493

View in Genome Browser
Species Human (GRCh38)
Location 9:136730180-136730202
Sequence TCTACCTTCTGAGCTGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062476486_1062476493 13 Left 1062476486 9:136730144-136730166 CCTGGAACTAGCACCCGAGTTGT No data
Right 1062476493 9:136730180-136730202 TCTACCTTCTGAGCTGGTGCAGG No data
1062476489_1062476493 0 Left 1062476489 9:136730157-136730179 CCCGAGTTGTAGCCGGAGCTGGC No data
Right 1062476493 9:136730180-136730202 TCTACCTTCTGAGCTGGTGCAGG No data
1062476490_1062476493 -1 Left 1062476490 9:136730158-136730180 CCGAGTTGTAGCCGGAGCTGGCT No data
Right 1062476493 9:136730180-136730202 TCTACCTTCTGAGCTGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062476493 Original CRISPR TCTACCTTCTGAGCTGGTGC AGG Intergenic
No off target data available for this crispr