ID: 1062478596

View in Genome Browser
Species Human (GRCh38)
Location 9:136741449-136741471
Sequence GGTCCCACGGGAGCAGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 413}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062478596_1062478607 -10 Left 1062478596 9:136741449-136741471 CCCGCCCCTGCTCCCGTGGGACC 0: 1
1: 0
2: 2
3: 36
4: 413
Right 1062478607 9:136741462-136741484 CCGTGGGACCCGGGAAGGTTGGG 0: 1
1: 0
2: 1
3: 6
4: 77
1062478596_1062478608 -9 Left 1062478596 9:136741449-136741471 CCCGCCCCTGCTCCCGTGGGACC 0: 1
1: 0
2: 2
3: 36
4: 413
Right 1062478608 9:136741463-136741485 CGTGGGACCCGGGAAGGTTGGGG 0: 1
1: 0
2: 2
3: 11
4: 160
1062478596_1062478610 -2 Left 1062478596 9:136741449-136741471 CCCGCCCCTGCTCCCGTGGGACC 0: 1
1: 0
2: 2
3: 36
4: 413
Right 1062478610 9:136741470-136741492 CCCGGGAAGGTTGGGGCCCCAGG 0: 1
1: 0
2: 2
3: 25
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062478596 Original CRISPR GGTCCCACGGGAGCAGGGGC GGG (reversed) Intronic
900103651 1:973256-973278 GGTCACCCGGGAGCAAGGCCCGG + Exonic
900156065 1:1203734-1203756 GCTGCCAGGGGAGCAGGGCCCGG + Exonic
900158136 1:1211737-1211759 GGTCCCTCCGGAGCAGGTACAGG + Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900299877 1:1971739-1971761 GGCCCCATGGGAGCAGGGCTGGG + Intronic
900464841 1:2820636-2820658 GGTACCACGGGCTGAGGGGCTGG + Intergenic
900513209 1:3069877-3069899 GGCTCCGCGGGCGCAGGGGCAGG + Intronic
900534611 1:3170690-3170712 GGGCCCGGGGGAGCAGGGGAAGG + Intronic
900654139 1:3746882-3746904 TGTCCCACAGGAGAAGGGGGAGG + Intergenic
901127282 1:6938466-6938488 GGGGCCACGGCAGCAGGGGAGGG + Intronic
901232109 1:7647090-7647112 GGTCCCTGGAGAGCAGGTGCTGG - Intronic
901796791 1:11684160-11684182 GGTTCCATGGGGGCGGGGGCAGG + Intronic
902608406 1:17582233-17582255 GTGCCCATGGCAGCAGGGGCGGG - Intronic
904619040 1:31764412-31764434 GGAGCCGCGGGAGAAGGGGCGGG + Intronic
904828994 1:33294812-33294834 GGTCCTTGGGGAGCATGGGCAGG + Intronic
905581356 1:39084632-39084654 GGTCTCACGTGAGCAAGGGGTGG - Intronic
906032453 1:42732528-42732550 GGTGCCAGTGGAGCAGGGGTGGG - Intergenic
906476669 1:46173912-46173934 GGTCCCAGGGCCGCAGGGGCAGG + Intronic
907703377 1:56811536-56811558 GGTCCACCTGGAGCAAGGGCTGG - Intronic
908780455 1:67685659-67685681 AGTCCCGAGGGAGCAAGGGCGGG - Intronic
908951965 1:69570510-69570532 GAACCCACGTGTGCAGGGGCTGG - Intronic
911411547 1:97515543-97515565 TGTCCCATGGAAGAAGGGGCAGG - Intronic
912467307 1:109882937-109882959 GGACCCAGGGAAGCAGGGACAGG + Intergenic
913090290 1:115472147-115472169 GGGCCAATGGGAGCAGAGGCAGG - Intergenic
914869214 1:151459100-151459122 GAACCCCCGGGAGCAGGGGGTGG + Intronic
915367894 1:155325570-155325592 GGTTCCAAGGGAGCGGGTGCTGG - Exonic
915453132 1:156020694-156020716 GGTCCCACGGGCGGGGGGGCGGG + Intronic
919819665 1:201465230-201465252 TCTCCCAGGGTAGCAGGGGCAGG + Intergenic
920281324 1:204845929-204845951 GGCTCCACGGGGGAAGGGGCTGG + Intronic
920338350 1:205259717-205259739 AGTTCCACGGGAGCCAGGGCTGG + Intronic
920525632 1:206663949-206663971 GGTGCCGTGGGAGCAGGTGCTGG + Intronic
924592462 1:245416713-245416735 GGCCCCACGGCAGAAGGAGCAGG + Intronic
1062904602 10:1171187-1171209 GCTCAGAAGGGAGCAGGGGCAGG - Intergenic
1065020227 10:21496593-21496615 GGGCCCACGGGTGCACGGCCCGG + Intronic
1067032078 10:42884829-42884851 GGTTTCAAGGGAGGAGGGGCAGG - Intergenic
1067369740 10:45672473-45672495 GGTCCCCGGGCAGCAGCGGCCGG + Intronic
1067419483 10:46133949-46133971 GGTCCCACAGGAGCAGGCGGGGG + Intergenic
1067426533 10:46215462-46215484 GGTGCCACAGGAGCAGGCGGGGG - Intergenic
1067504834 10:46840546-46840568 GGTCCCACAGGAGCTGGCGGGGG + Intergenic
1067960947 10:50848784-50848806 GGACCCAAGGGAACAGGAGCAGG - Intronic
1068917310 10:62446212-62446234 GATCACACAGGAGCAGGGACTGG - Intronic
1069877786 10:71573805-71573827 GGCCCCAGGGGAGCCGGGCCAGG - Intronic
1070605914 10:77898476-77898498 AGGCACATGGGAGCAGGGGCTGG + Intronic
1070982182 10:80657809-80657831 GGTCTCCAGGAAGCAGGGGCTGG + Intergenic
1071521360 10:86333049-86333071 GGTCTCCCAGGAGCAGGAGCTGG - Intronic
1071525283 10:86354716-86354738 GGTCCCGGGGAGGCAGGGGCAGG + Intronic
1072549108 10:96463690-96463712 GGTCCCAAGGGAGCTGGAGCTGG - Intronic
1073436238 10:103517889-103517911 AGGCCCACGGGAGCAGAGCCAGG - Intronic
1074317209 10:112370652-112370674 GGGCGCAGTGGAGCAGGGGCCGG - Intergenic
1075091093 10:119444537-119444559 GGCCCCAAGGGGGCATGGGCTGG - Intronic
1075375532 10:121975235-121975257 GTTCCGCCGGGAGCAGGCGCTGG - Intergenic
1075645255 10:124092583-124092605 GGTCCCACGGGCTTAGGCGCGGG + Intronic
1075945274 10:126427648-126427670 TGTCCAACGGCAGGAGGGGCGGG - Intronic
1076294708 10:129375475-129375497 GGTGCCCTTGGAGCAGGGGCTGG + Intergenic
1076366881 10:129926898-129926920 TGTCCCCCGGGAGCAGGCTCTGG - Intronic
1076464146 10:130666803-130666825 TGTCCCAAGTGAGCAGGGGTTGG + Intergenic
1076590309 10:131578084-131578106 GGGACCACGGCAGCAGGGCCAGG - Intergenic
1077090585 11:776769-776791 GGTCTCAGGGCAGCAGGGGAGGG - Intronic
1077130230 11:968366-968388 GGTCCCGCGGGAGCAGAGGCTGG + Intronic
1077144786 11:1040031-1040053 GGGCCCAGCGGGGCAGGGGCAGG - Intergenic
1077225542 11:1437696-1437718 GGCCTCACAGGAGGAGGGGCCGG - Intronic
1077417656 11:2432374-2432396 GGCCCCGTGGGGGCAGGGGCTGG - Intergenic
1077447238 11:2602081-2602103 GTGGCCACGGAAGCAGGGGCAGG + Intronic
1078250764 11:9614504-9614526 GGCCCCACCGGAGCCGGTGCCGG - Intergenic
1078514405 11:12009536-12009558 GATGCCGCGGGCGCAGGGGCAGG - Intronic
1079158700 11:17973259-17973281 GGTCCCACAGGAGCAGGATCAGG + Intronic
1080002230 11:27363059-27363081 GGGCGCACGTGGGCAGGGGCTGG - Exonic
1080346862 11:31335195-31335217 GGACCCACTGAAGCAGGTGCGGG + Intronic
1081528633 11:43943347-43943369 GGTCCCCCGGGAGCAGGGCGCGG - Intronic
1081643485 11:44774257-44774279 TGTCCCACGGGAGAAGGAGGGGG + Intronic
1083424259 11:62574965-62574987 GGTCAGACGGGAGCAGCTGCAGG + Intronic
1083902368 11:65649874-65649896 GGACCCAGGAGAGCAGGGGAGGG + Intronic
1084189645 11:67493188-67493210 AGTCCCACGGGGACAGGGGCGGG + Intronic
1084430634 11:69108878-69108900 GCTCCCAAAGGGGCAGGGGCAGG - Intergenic
1085030844 11:73270028-73270050 GGCCCCACAGGATGAGGGGCTGG + Intronic
1085274898 11:75292083-75292105 GCTCCCAGGGGAGGTGGGGCGGG - Intronic
1085388929 11:76172373-76172395 GCTGGCACGGGAGCAGAGGCAGG - Intergenic
1085529521 11:77183236-77183258 GGGCCCACGGAAGCAGGAGCAGG + Intronic
1085533172 11:77203472-77203494 GGTCCCATGAGGCCAGGGGCTGG - Intronic
1087137373 11:94734641-94734663 TCTCCCAGGGGAGCATGGGCAGG - Intronic
1091219863 11:133924022-133924044 GGGAGCACGAGAGCAGGGGCAGG - Intronic
1091230471 11:133984774-133984796 GGTGCAAAGGGAGCAGGGGCCGG + Intergenic
1091584483 12:1808248-1808270 GCTGCCTCTGGAGCAGGGGCTGG + Intronic
1091671469 12:2455023-2455045 GGTGCCACCCGTGCAGGGGCAGG - Intronic
1092527067 12:9315809-9315831 GGTCCCAGGACAGCAGGTGCTGG - Intergenic
1092530388 12:9339322-9339344 AGCCCCAGGGGAGCAGGGGCTGG + Intergenic
1092540202 12:9415963-9415985 GGTCCCAGGACAGCAGGTGCTGG + Intergenic
1092615636 12:10213255-10213277 GGGCCCGCGGGGGCGGGGGCGGG + Intronic
1094512840 12:31106493-31106515 GGTCCCAGGACAGCAGGTGCCGG - Intergenic
1099528142 12:83741113-83741135 GGTGCCACTGGAGTATGGGCGGG - Intergenic
1100453405 12:94729279-94729301 GGTCCCACGGGGTGAGGGGTGGG + Intergenic
1101782028 12:107845426-107845448 GGTCCCTCACGAGAAGGGGCGGG + Intergenic
1102005958 12:109589346-109589368 GGTGCCACGGGAGCAGATGGCGG + Intronic
1102058654 12:109915596-109915618 AGGCCCAGGGGAGCAGGGGCCGG - Intronic
1102725449 12:115060386-115060408 GGTATCACAGGAGCTGGGGCAGG + Intergenic
1103091996 12:118104058-118104080 GGTCCCGCCGGGCCAGGGGCGGG + Intronic
1103359504 12:120345579-120345601 GGTACCACTGAAGCAGGGGACGG - Exonic
1103451987 12:121035738-121035760 GGTCCCTTGGAAGCAGGGCCTGG - Intronic
1103794589 12:123494586-123494608 GGCCCCACGGGAGCTCAGGCTGG - Intronic
1104420447 12:128630280-128630302 GGTCACTAGGGGGCAGGGGCTGG + Intronic
1104639341 12:130457489-130457511 AGTCCCAGGGGAGCAGGGAGCGG - Intronic
1104765583 12:131328090-131328112 GCTCCCTGGGGAGCAGTGGCAGG + Intergenic
1104813740 12:131633962-131633984 GCTCCCTGGGGAGCAGTGGCAGG - Intergenic
1104820996 12:131677560-131677582 GGTCACCCGGGCTCAGGGGCGGG + Intergenic
1108750167 13:53439975-53439997 GGTCGCAGCGGAGCAGGGGGTGG - Intergenic
1109233698 13:59790090-59790112 AGTCCCATGGGAACAAGGGCTGG - Intronic
1112734410 13:102400723-102400745 GGTCCCACAGGGCCAGGGGTGGG - Intronic
1113654745 13:112061116-112061138 GGTCCCCCGGGAGCCGCGCCTGG - Intergenic
1113659137 13:112092795-112092817 GGTCCCAGAGGAGCCCGGGCAGG - Intergenic
1114031301 14:18583306-18583328 GGTGATACGGGAGCAGGGGTCGG + Intergenic
1114227822 14:20754912-20754934 GGTCCACCTGGAGCATGGGCTGG - Intergenic
1114229079 14:20764250-20764272 GGTCCACCTGGAGCATGGGCTGG - Intergenic
1115645367 14:35365530-35365552 GGCCCCACGGGAGGTGGGCCTGG - Intergenic
1115770148 14:36658895-36658917 CGCCCAAGGGGAGCAGGGGCCGG - Intronic
1116820473 14:49621607-49621629 GGCCCCCCGGGAGCTGGTGCTGG + Exonic
1117285533 14:54282760-54282782 GGGTCCAAGGCAGCAGGGGCTGG + Intergenic
1118636529 14:67753255-67753277 TGTGGCACTGGAGCAGGGGCTGG - Intronic
1118734185 14:68690348-68690370 AGTCAGAGGGGAGCAGGGGCTGG + Intronic
1119805937 14:77482493-77482515 GGCCCCAGGGGAGAAGGGGGAGG - Exonic
1119960379 14:78848932-78848954 GGGGCCACGGGAGCAGGAGTGGG + Intronic
1121463586 14:94100378-94100400 GCTGCCACGGGGGCAGGGACTGG - Intronic
1121778608 14:96607335-96607357 GGTCCCAAGGGTGTATGGGCAGG + Intergenic
1122444343 14:101758352-101758374 TGTCCCAGAGGAGCAGGGGTTGG + Intergenic
1122649834 14:103220410-103220432 GGTCCCATGGGATGGGGGGCCGG - Intergenic
1122992011 14:105240956-105240978 GGCCCCACGAGACCACGGGCAGG + Intronic
1123047745 14:105526918-105526940 GAGCCCCCGGGAGGAGGGGCGGG - Intronic
1124661754 15:31555528-31555550 GGGGCCACGGGAGCAGAGCCTGG + Intronic
1124818533 15:33019917-33019939 GCTCCCACGGGTGCAGTGGTGGG + Intronic
1126098626 15:45106513-45106535 AGTGCCAGGTGAGCAGGGGCTGG - Exonic
1126798652 15:52280975-52280997 GGTAACAGGGGAGCAGGAGCTGG - Intronic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1132036544 15:98489892-98489914 GGTCTCTAGGGAGGAGGGGCTGG - Intronic
1132105404 15:99059329-99059351 GGGCCCGCGGGAGGAGGGGGAGG - Intergenic
1132586241 16:706748-706770 GGTCTCCTGGGAGCAGGGCCGGG + Intronic
1132600218 16:769767-769789 GGTCCCAGGAGAGCAGCCGCAGG - Intronic
1132602569 16:780186-780208 GTCCCGGCGGGAGCAGGGGCCGG + Intronic
1132657572 16:1047819-1047841 GGGCGCCCAGGAGCAGGGGCGGG - Intergenic
1132690024 16:1178105-1178127 GGTCCCCAGGGAGAGGGGGCGGG - Intronic
1132714652 16:1284688-1284710 GTTCCCAGGGGACAAGGGGCCGG + Intergenic
1132829646 16:1921048-1921070 GGCCCTGCGGGAACAGGGGCGGG + Intergenic
1132888811 16:2194426-2194448 GGTGACTCTGGAGCAGGGGCTGG + Intronic
1132938963 16:2497497-2497519 AGCCCCAGGGGAGCAGGGTCAGG + Intronic
1133028861 16:3000354-3000376 GGTGCCTGGGGAGCAGGGGTCGG + Intergenic
1133033178 16:3021218-3021240 GCTGCCGCGGGAGCAGGGGGCGG - Exonic
1133310777 16:4845497-4845519 GGTCACATTGGAGCAGGGGTGGG - Intronic
1133350253 16:5096620-5096642 GGTCACACAGGGCCAGGGGCTGG + Intronic
1134850489 16:17474686-17474708 GAACCCCTGGGAGCAGGGGCCGG + Intergenic
1136284584 16:29233519-29233541 GGTCAAATCGGAGCAGGGGCAGG + Intergenic
1136637936 16:31537582-31537604 GGTCCCAGGTGAGCTGCGGCCGG - Intergenic
1136666790 16:31819571-31819593 GGTCCCAGGTGAGCTGCGGCCGG + Intergenic
1136990165 16:35147169-35147191 GGCCCCAGGGGATCAGGGTCTGG - Intergenic
1137731451 16:50693523-50693545 GGTCCCGGCAGAGCAGGGGCGGG + Intergenic
1138191434 16:55017098-55017120 GAGCACATGGGAGCAGGGGCTGG + Intergenic
1141423320 16:83930964-83930986 GGTCACACGCAAGCAGGTGCTGG - Intronic
1141520030 16:84572362-84572384 ACACCCACGGGGGCAGGGGCAGG + Intronic
1141763730 16:86045362-86045384 GTTCCCATTGGAGCAGGGCCAGG + Intergenic
1141766127 16:86061003-86061025 GGTCCCTCGGGAGAAGGGGCAGG + Intergenic
1141984779 16:87572685-87572707 GGTCCCACAGGTGCAGGTGCTGG + Intergenic
1142280125 16:89143620-89143642 GGTCCCACGGGACTTGGGACAGG + Intronic
1142317957 16:89361062-89361084 GGTGCCATTGCAGCAGGGGCTGG - Intronic
1142377646 16:89714584-89714606 GGCCCCGCCAGAGCAGGGGCAGG + Intronic
1142741420 17:1934026-1934048 GGCCACAGGGGAGCAGGTGCAGG + Intergenic
1142850658 17:2703261-2703283 GGGCCCACGGAGGCAGAGGCAGG - Intronic
1142883976 17:2901409-2901431 GGACCCATGAGAGGAGGGGCTGG - Intronic
1142978372 17:3658233-3658255 TGCCCCACCGGAGCAGGGCCTGG - Intronic
1143303037 17:5925112-5925134 GAACCCAAGGGTGCAGGGGCTGG + Intronic
1143625907 17:8110051-8110073 GGGCCCAGCGGGGCAGGGGCCGG - Intronic
1143904811 17:10199515-10199537 GGTCCCTGGAGAGCAGGGACTGG - Intergenic
1144949305 17:18985445-18985467 GGGCCCAAAGGAGCTGGGGCAGG + Intronic
1146000430 17:29127443-29127465 GGTCCCAGGGGATGAGTGGCTGG + Intronic
1146305948 17:31729922-31729944 TGTTCCAAGGTAGCAGGGGCAGG - Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147159664 17:38562760-38562782 GGGTCCAGGGGAGCAGGGTCTGG - Intronic
1147819164 17:43231517-43231539 GGGCTTCCGGGAGCAGGGGCTGG + Intergenic
1147819750 17:43234548-43234570 GGGCTTCCGGGAGCAGGGGCTGG + Intergenic
1147821062 17:43241946-43241968 GGGCTTCCGGGAGCAGGGGCTGG + Intergenic
1147821868 17:43246435-43246457 GGGCTTCCGGGAGCAGGGGCTGG + Intergenic
1147825470 17:43267394-43267416 GGGCTTCCGGGAGCAGGGGCTGG + Intergenic
1147826601 17:43273861-43273883 GGGCTTCCGGGAGCAGGGGCTGG + Intergenic
1147827490 17:43278739-43278761 GGGCTTCCGGGAGCAGGGGCTGG + Intergenic
1147828598 17:43284900-43284922 GGGCTTCCGGGAGCAGGGGCTGG + Intergenic
1147829705 17:43291051-43291073 GGGCTTCCGGGAGCAGGGGCTGG + Intergenic
1147830786 17:43297174-43297196 GGGCTTCCGGGAGCAGGGGCTGG + Intergenic
1147831484 17:43300802-43300824 GGGCTTCCGGGAGCAGGGGCTGG + Intergenic
1148857051 17:50584581-50584603 GGGCCCAGGGGAGCCGGGGGCGG + Intronic
1150249840 17:63699509-63699531 GGCCCCTGGGGAGCAGGGGTGGG - Intronic
1151757990 17:76085594-76085616 GAGCCCAGGGGGGCAGGGGCTGG + Intronic
1152233933 17:79128707-79128729 GTCCCCACAGGAGCAGGGGCAGG - Intronic
1152360764 17:79832147-79832169 GGTCCCAGGCGGGCAGGGGAAGG + Intergenic
1152544168 17:80992351-80992373 GGGCCCGCGGGAGCAGGTCCCGG + Intronic
1152627477 17:81394174-81394196 GGTCCCGCGGGAGCGGGAGTGGG + Intergenic
1152687238 17:81700658-81700680 AGTGCCATGGGAGAAGGGGCTGG - Intronic
1152875371 17:82783522-82783544 GGATCCACGGCTGCAGGGGCTGG - Intronic
1153428851 18:4993253-4993275 GGGGCCAAGGCAGCAGGGGCTGG + Intergenic
1154107224 18:11533582-11533604 CGTGCCACTGGAGCAGGAGCAGG - Intergenic
1156449648 18:37259648-37259670 GGTCCCCCCAGAGCAGGGGCAGG - Intronic
1159607272 18:70487859-70487881 ACTCCCAAGGGAGTAGGGGCAGG + Intergenic
1160228939 18:77032071-77032093 TGTCCCACTGGAGAAGGCGCCGG + Intronic
1160722566 19:603986-604008 GGGGCCAAGGCAGCAGGGGCGGG + Intronic
1160722580 19:604028-604050 GGGGCCAAGGCAGCAGGGGCGGG + Intronic
1161021899 19:2014806-2014828 GGTCCCAGGGGTACAGGGCCTGG + Intronic
1161467128 19:4437227-4437249 CGTCCCTGGGGAGCAGGGTCTGG + Intronic
1161568389 19:5016368-5016390 GGCCCCACAGGACCAGGGACCGG + Intronic
1162128480 19:8511736-8511758 GGTCCGGTGGGGGCAGGGGCGGG + Exonic
1162475570 19:10897502-10897524 GGGGCCAAGGGAGGAGGGGCTGG - Intronic
1162565792 19:11445408-11445430 GGCCCAACAGGAGCAGGAGCTGG + Exonic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1163404240 19:17112583-17112605 GGTCCCAAGGGAGGAGGAGAGGG + Intronic
1163764158 19:19153122-19153144 GGTCCCACGAGAGCAGCAGCAGG + Intronic
1163861848 19:19747021-19747043 TGGCCCAGGGGAGGAGGGGCAGG - Intergenic
1164052169 19:21592866-21592888 TGACCCACTGGAGCCGGGGCTGG - Intergenic
1164608066 19:29614124-29614146 GGAGCCACGGGTGCAGGGGATGG - Intronic
1165210618 19:34232705-34232727 GATCCCACAGGAGCAGTGCCTGG - Intergenic
1165447153 19:35862612-35862634 GGGGCCTCGGGAGCCGGGGCGGG - Intronic
1165665520 19:37624065-37624087 GGTCCCACGGTAGCATATGCTGG - Intronic
1165914012 19:39247168-39247190 GCTCCCACGTGAGCAGGCGCAGG + Intergenic
1165916849 19:39265760-39265782 GCTCCCACGTGAGCAGGCGCAGG - Intergenic
1165938458 19:39403350-39403372 GGTTCCGAGGGAGGAGGGGCTGG + Intergenic
1165955313 19:39498860-39498882 GGCCCCAAGGGACCAAGGGCGGG - Intergenic
1166336973 19:42114167-42114189 GGTCCCTGGGGAGCTGGGGGAGG + Intronic
1166373648 19:42315538-42315560 GGTCCTGGGGGAGGAGGGGCTGG + Intronic
1166373678 19:42315613-42315635 GGTCCTGGGGGAGAAGGGGCTGG + Intronic
1166735195 19:45079748-45079770 GGCCCCAGGGGAGAAGGGGAGGG + Intronic
1167277173 19:48545525-48545547 GTTCCCGAGGGGGCAGGGGCTGG - Intergenic
1167368132 19:49065252-49065274 GGTCTGAAGGGAGGAGGGGCTGG - Intergenic
1167517367 19:49930944-49930966 GGAGCCAGGGGGGCAGGGGCCGG - Exonic
1167593168 19:50415180-50415202 GTTCCCAGAGGAGGAGGGGCTGG - Intronic
1167596912 19:50432719-50432741 GGTCCCCAGGGAGGAGGGGCTGG - Intergenic
1167666852 19:50827321-50827343 GGTCCTTGAGGAGCAGGGGCTGG - Intronic
1168058909 19:53879571-53879593 GGTCTCCCGGGAGCGGGGACTGG + Intronic
1168236042 19:55063641-55063663 GGGTCCAAGGGAGGAGGGGCTGG + Intronic
1168332984 19:55580491-55580513 GGTCCCGGTGGAGGAGGGGCTGG + Intronic
1168406814 19:56114785-56114807 GGTACCAGGGCAGCAGGTGCTGG - Intronic
1168516290 19:57012911-57012933 TGTCCCACGGGAGCAGTGGATGG + Intergenic
925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG + Intergenic
925451578 2:3973696-3973718 GGTCCCACAGCAGGAAGGGCTGG - Intergenic
926694676 2:15763028-15763050 GGTCCCAAGGAAGAAGGGGATGG + Intergenic
927216634 2:20671088-20671110 GGGGCCACGGGCGCAGGGGCCGG + Exonic
927990436 2:27443220-27443242 GGTACCACTGGATGAGGGGCCGG + Exonic
928167227 2:28980179-28980201 GGTCCCTCTGGGGCAGGTGCTGG - Intronic
929808910 2:45171080-45171102 ACTCCCACGGGCGCAGGGGTTGG + Intergenic
931047800 2:58376067-58376089 GGTCCTACTGGAGTAGGGGTGGG - Intergenic
934604484 2:95683406-95683428 GGTCCCAGGGGATCAGGGTGTGG - Intergenic
936164159 2:110105441-110105463 GGTCCCACGGGCACAGAGGTTGG + Intronic
936348992 2:111698320-111698342 GGTCACAGGGCAGCAGGGCCGGG + Intergenic
936537886 2:113325637-113325659 GGTCCCAGGGGATCAGGGTGTGG - Intergenic
936556912 2:113503918-113503940 GGTCCAAGGGGCGCGGGGGCCGG + Intergenic
937110933 2:119366835-119366857 GGTCCCACGTGGGCTCGGGCGGG + Intergenic
938391769 2:130912270-130912292 GGCCCCACGGAGGCAGCGGCCGG + Intronic
942449618 2:176100727-176100749 GGTGCTTCGGGAGCAGGCGCTGG + Exonic
945116769 2:206415866-206415888 GGACCCACTGAACCAGGGGCAGG + Intergenic
946079907 2:217108904-217108926 GGTCCCACTGCAGCAGGGTCTGG + Intergenic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
946567631 2:220984542-220984564 GGTACGACAGGAGCTGGGGCAGG + Intergenic
947447971 2:230179283-230179305 GGCCTCACAGGAGCAGGGGCTGG + Intronic
947628110 2:231633979-231634001 GGCCCCAGGGGAGGAGGGCCAGG + Intergenic
947791700 2:232872504-232872526 TGACCCAGGGAAGCAGGGGCTGG - Intronic
948158235 2:235801718-235801740 TGTGCCCCGGGAGGAGGGGCGGG + Intronic
948383744 2:237568602-237568624 GTTCCGAAGGCAGCAGGGGCTGG + Intergenic
948662279 2:239514974-239514996 TGTCACACGGGGGCAGCGGCGGG - Intergenic
948704466 2:239780294-239780316 CTCCCCACAGGAGCAGGGGCTGG + Exonic
948746225 2:240095905-240095927 GGGCCCGCGGGTGCAGGGGCTGG + Intergenic
948803433 2:240443018-240443040 AGGCCCACGGCAGGAGGGGCTGG - Intronic
948911808 2:241008720-241008742 GGCACCACGGGAGCAGGGCAGGG - Intronic
949000467 2:241610234-241610256 GGCCGCCCGGGAGCAGAGGCAGG - Intronic
949022483 2:241749309-241749331 GGTCTCACAGGCGCAGAGGCTGG - Intronic
949031489 2:241799349-241799371 GGGCTCTGGGGAGCAGGGGCCGG + Intronic
1168878306 20:1185687-1185709 CGGTCCACGGGCGCAGGGGCGGG + Intronic
1172266822 20:33623120-33623142 GTTCCCGCTGCAGCAGGGGCAGG - Exonic
1172697637 20:36833466-36833488 GATGCCTGGGGAGCAGGGGCTGG - Intronic
1172786046 20:37469563-37469585 GGTCCTAGGGGAGCAGGAGAAGG - Intergenic
1173729121 20:45316608-45316630 GGGCCCCGGGGAGCAGGGGAAGG + Intronic
1173865111 20:46308220-46308242 GGTGCCGCGGGAGGAGCGGCCGG - Intronic
1174176568 20:48649259-48649281 TGTCCGGCGTGAGCAGGGGCAGG - Intronic
1174458205 20:50664533-50664555 GATCCCACGGGAAAGGGGGCTGG + Intronic
1175402580 20:58708853-58708875 GGTGGCACGGGGGCAGGGGTGGG + Intronic
1175712893 20:61235246-61235268 GAGCCCACGGCAGCAGGGGAAGG + Intergenic
1175757743 20:61540126-61540148 GGTCCTCCTGGAGCAGGGCCTGG + Intronic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176715657 21:10347132-10347154 GGTCTCATGAGAGCAGGGACTGG - Intergenic
1178641235 21:34345985-34346007 GATCCCCCGGGACCTGGGGCAGG - Intergenic
1179441829 21:41400196-41400218 GGTGCCAGGGGACCAGGGGAGGG + Intronic
1179931520 21:44573949-44573971 GGTCACTGGGCAGCAGGGGCTGG - Exonic
1179934232 21:44592272-44592294 GGTCACTGGGCAGCAGGGGCTGG + Exonic
1179935401 21:44600812-44600834 GGTCACTCGGCAGCAGGGGCTGG - Exonic
1179939200 21:44627332-44627354 GGTCACCTGGCAGCAGGGGCTGG - Exonic
1179948636 21:44697377-44697399 GGTCACTCGGCAGCAGGGGCTGG - Exonic
1180142907 21:45903135-45903157 GGTCCCAAGGAAGCAGTGTCTGG + Intronic
1180455414 22:15510364-15510386 GGTGATACGGGAGCAGGGGTCGG + Intergenic
1180602687 22:17032821-17032843 GGTCTCATGAGAGCAGGGACTGG + Intergenic
1180954439 22:19735377-19735399 GGGCACACGGGAACAAGGGCTGG - Intergenic
1181031151 22:20149390-20149412 GGTAACACGGGGGCAGGGGCCGG - Exonic
1181282642 22:21730807-21730829 GTTCCCCAGAGAGCAGGGGCTGG - Intronic
1181512184 22:23394006-23394028 GGTAACACAGGGGCAGGGGCTGG + Intergenic
1181601540 22:23955115-23955137 GGTCACCTGGCAGCAGGGGCAGG - Intergenic
1181846414 22:25712887-25712909 GCTCTCACGGGAGCAGGACCTGG - Intronic
1182355505 22:29720742-29720764 GGGACCACGCGGGCAGGGGCTGG - Intronic
1182509228 22:30807219-30807241 AGTCTCGCGGGGGCAGGGGCTGG - Intronic
1183540622 22:38427409-38427431 GGTCCCGCTGGTCCAGGGGCAGG + Exonic
1183738462 22:39656946-39656968 AGTCCCAGGGGAGCCGTGGCAGG + Intronic
1184115045 22:42417401-42417423 GGTCCCATGGGATCTGGGGCAGG + Intronic
1184153029 22:42649384-42649406 CGTCACTCCGGAGCAGGGGCGGG + Intronic
1184241404 22:43212892-43212914 GGACCCACAGGTGGAGGGGCAGG + Intronic
1184274011 22:43400035-43400057 GGTCACCTGGGAGCTGGGGCTGG + Intergenic
1184757792 22:46526649-46526671 GGGCCCACGGGTGCAGGCCCTGG - Intronic
1185272510 22:49935644-49935666 GGTCCGGGAGGAGCAGGGGCGGG + Intergenic
950096961 3:10336061-10336083 GCTCCCAGGCGGGCAGGGGCTGG - Intronic
950136809 3:10586877-10586899 GGTGCCATGTGAGCAGGGACCGG - Intronic
950208304 3:11096855-11096877 GGTCCCCCGGGGGCTGGGGACGG + Intergenic
950273525 3:11639251-11639273 AGTCCCCAGGGAGCAGGGACAGG - Intronic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
951262172 3:20523331-20523353 GCCCCCACTGGAGCAGGTGCTGG - Intergenic
951501145 3:23389094-23389116 GGTCCCACAGGGGCAGTGGCAGG + Intronic
952334439 3:32392279-32392301 GGGTCCGCGGGAGCAAGGGCCGG - Intronic
952931118 3:38361747-38361769 GGTGCAGCCGGAGCAGGGGCTGG - Intronic
954378028 3:50205172-50205194 CGGCCCGCGGGAGGAGGGGCTGG - Intergenic
954535726 3:51358094-51358116 GGTTCTACTGCAGCAGGGGCAGG - Intronic
954878456 3:53818484-53818506 AGCCCCACTGTAGCAGGGGCAGG - Intronic
955383490 3:58460265-58460287 GGTCACACGTGGGCAGGGACAGG + Intergenic
955531373 3:59876464-59876486 ACTCCCACAGCAGCAGGGGCTGG - Intronic
956106739 3:65827124-65827146 AGTCCCAAGGAACCAGGGGCTGG + Intronic
957044520 3:75363543-75363565 GGTCACAAGGGTGCAGGGACCGG - Intergenic
958022685 3:88016016-88016038 GGACGCCCGGGAGCAGGGGGCGG - Intergenic
959920019 3:111859593-111859615 GGTCGCCCGGGAGGAGGGGGTGG + Intronic
961305971 3:125959288-125959310 TGGCCCACGGCCGCAGGGGCCGG - Intergenic
961448514 3:126992105-126992127 GGCCCCACGGTGGCAGGGGGAGG + Intronic
961504904 3:127363436-127363458 GGACCCACGTGAGGAGAGGCAGG - Intergenic
961762688 3:129183458-129183480 GGCCCCAAGGGCGCACGGGCGGG + Intronic
964479982 3:157130529-157130551 GGTCACACGGTGGCAGAGGCAGG - Intergenic
965395974 3:168160798-168160820 GGTCCCAAGGGAGCAGATGAGGG + Intergenic
966787842 3:183636456-183636478 CGTCCCCGGGGAGCCGGGGCGGG + Intronic
967915935 3:194578207-194578229 TGTCCCAGCCGAGCAGGGGCTGG - Intergenic
967975344 3:195031284-195031306 GGTCCCTCGGCAGCCAGGGCAGG + Intergenic
968037885 3:195563566-195563588 GGAGCCACGGGAGAAGAGGCAGG + Intergenic
968431375 4:561095-561117 GTTCCCACGGGGGCTGGGGGAGG + Intergenic
968661087 4:1799116-1799138 GGTCCCACCAGACCAGGGGCTGG - Intronic
968736346 4:2298720-2298742 CGTCCCACGGGGGCAAGGCCAGG - Intronic
968744603 4:2353178-2353200 GTTCCCACCGCAGCAGGGCCAGG + Intronic
968997359 4:3954300-3954322 GGTCACACAGGGCCAGGGGCTGG + Intergenic
969213072 4:5702352-5702374 GGTTCCTCAAGAGCAGGGGCAGG + Intronic
969515990 4:7648545-7648567 GGCCCCACGAGGGCAGGGGTTGG - Intronic
969708987 4:8831942-8831964 GGGCTCACCGGAGCGGGGGCTGG + Intergenic
970491822 4:16582797-16582819 GGTCCCAGTGGAGCTGTGGCTGG - Intronic
971280499 4:25239326-25239348 GATCCCACAGCAGCAGGGGGAGG + Intronic
972635067 4:40877012-40877034 GGACCCACAGGAGCAGGGTCGGG + Intronic
974572423 4:63670141-63670163 GAGTCCACAGGAGCAGGGGCTGG - Intergenic
980013616 4:127623333-127623355 GGTTCGGCGGGAGCCGGGGCTGG + Intronic
981288267 4:143045205-143045227 AGTGCCACTGCAGCAGGGGCTGG + Intergenic
982291977 4:153790181-153790203 GGCTCCACGAGAGCAGAGGCCGG - Intergenic
983000581 4:162409154-162409176 GCTCCCAAGGTAGCAGGCGCTGG + Intergenic
985483751 5:137238-137260 GGTGCCAGGGGCTCAGGGGCAGG + Intergenic
985832183 5:2242022-2242044 GGTCCCCGGGGAGCCAGGGCAGG - Intergenic
986000020 5:3623061-3623083 GAGCCCACGGGAGCAGGCTCTGG + Intergenic
986551366 5:8959538-8959560 GGTCTCACTGGGGTAGGGGCAGG - Intergenic
990488449 5:56281136-56281158 GGGCCCACTGGAGCAGGAGCTGG - Intergenic
992359779 5:76025247-76025269 TGTCCCACTGGAGCATAGGCAGG + Intergenic
993068910 5:83134003-83134025 GGTTCCAGGTGAGCACGGGCTGG + Intronic
996713659 5:126568477-126568499 TGTCCCAGGGGAGCAAGGGAAGG + Intronic
997329991 5:133052831-133052853 CGTCCCACGTGAGTGGGGGCGGG + Intronic
997699721 5:135888472-135888494 GGATCCACGGGTGCAGGAGCGGG - Exonic
999518224 5:152322228-152322250 GCTCTCACTGGAGCAGTGGCAGG + Intergenic
1000041212 5:157486480-157486502 AGTCCCAGGGGTGCAGGTGCAGG + Intronic
1000343919 5:160298511-160298533 AGGCCCAGGGGAGCAGGCGCTGG - Intronic
1001708629 5:173760321-173760343 GGCCCCACGGGAGGAGGAGTTGG - Intergenic
1002394384 5:178941678-178941700 GGTCCCTCGGGGGCTGTGGCAGG - Intronic
1002460617 5:179371797-179371819 GGGGCCTGGGGAGCAGGGGCTGG - Intergenic
1006180423 6:32150636-32150658 GGTGCCCCGGCAGCAGGGCCGGG + Exonic
1006304515 6:33211288-33211310 GGTCGCTTGGGAGCAGGGCCTGG - Exonic
1006541216 6:34741406-34741428 GGTCTCACTGGATCAGGGTCAGG + Intergenic
1006912399 6:37571920-37571942 GGTGCAAGGGCAGCAGGGGCTGG - Intergenic
1007173275 6:39879304-39879326 GGTCCCCCGGGAGGAAGGGGTGG - Exonic
1014041486 6:116832074-116832096 GATACTCCGGGAGCAGGGGCAGG + Intergenic
1014336706 6:120146834-120146856 GGTCCTGCAGGAGCAGGAGCAGG - Intergenic
1017962495 6:159233855-159233877 TCTCCCACAGGCGCAGGGGCAGG + Exonic
1018669156 6:166165742-166165764 GGTCTCAGGGAAGCAGTGGCTGG + Exonic
1019181882 6:170192524-170192546 GGTCCCAAGAGAGCAGGGCCTGG - Intergenic
1019415564 7:925219-925241 GGTCTTCGGGGAGCAGGGGCTGG - Intronic
1019550159 7:1598191-1598213 GGCCCAGAGGGAGCAGGGGCTGG - Intergenic
1019595034 7:1854508-1854530 TGTCACACGGGGGAAGGGGCGGG + Intronic
1019750339 7:2725229-2725251 GGTCCTCCGGGTTCAGGGGCTGG + Intronic
1019991729 7:4696590-4696612 AGTCCCTCGAGGGCAGGGGCTGG + Intronic
1021959072 7:25854308-25854330 GGTCTCACTGGAGCAGAGCCTGG - Intergenic
1022493301 7:30837219-30837241 GGTCACAGGGGACCAGGAGCAGG + Intronic
1024572134 7:50732141-50732163 GGACACGCTGGAGCAGGGGCTGG - Intronic
1025617152 7:63130664-63130686 GGGCTCATGGGGGCAGGGGCAGG - Intergenic
1026104750 7:67411917-67411939 GGTCACACAGCAGCAGGGGGTGG - Intergenic
1027228620 7:76260098-76260120 GGTCCTGGGGGAGAAGGGGCGGG - Exonic
1027420739 7:78015437-78015459 AGTATCAGGGGAGCAGGGGCAGG + Intergenic
1027926776 7:84475100-84475122 GGTCCCAGGAGTGCAGGGGCTGG + Intronic
1029446441 7:100615446-100615468 GGTCCCCTGGGAACAGGGGTGGG - Intergenic
1029736636 7:102469069-102469091 GGTCCCAGGGGTGAAGGGGAGGG - Intronic
1030304259 7:108003044-108003066 GCTCCCACGGAAGCGGGGGGTGG + Intronic
1031700573 7:124919887-124919909 AGTCCCATGGGGGCAGGGACAGG - Intronic
1031902905 7:127429448-127429470 GAGCCCACGGCAGCAGGGGGAGG - Intronic
1033030450 7:137820938-137820960 GGCCCCAGGGGAGGAGGGGAGGG - Intronic
1034467779 7:151239884-151239906 AGTCCCAGGGGAGGAGGGGATGG + Intronic
1035340522 7:158157774-158157796 TCTCCCAGGGGAGCAGGCGCAGG - Intronic
1035625780 8:1069363-1069385 GGTCTCACTGGAGGACGGGCCGG + Intergenic
1036027666 8:4928127-4928149 CGTCCCACGTGGGCAGAGGCTGG - Intronic
1036979940 8:13459564-13459586 GTTCCAATGGGGGCAGGGGCTGG + Intronic
1038241146 8:25808899-25808921 GGTCCCACCTGGGCAGGGGAGGG + Intergenic
1040582086 8:48706347-48706369 GCTCTGACGGCAGCAGGGGCGGG - Intergenic
1044640923 8:94380895-94380917 GATCACATGGGAGCAGGGCCTGG - Intronic
1044901294 8:96947961-96947983 GGTCCACCTGGAGCATGGGCTGG - Intronic
1048588447 8:135798068-135798090 GGTCCTGCTGGAGCTGGGGCAGG + Intergenic
1048590590 8:135817447-135817469 GGTCCAACGGGGGCAGAGTCAGG - Intergenic
1048602309 8:135931205-135931227 GGTGCCAGGGAAGAAGGGGCAGG + Intergenic
1049317158 8:141975438-141975460 GGTCACCCAGGAGCAGGTGCAGG + Intergenic
1049424344 8:142531453-142531475 GGTGCACAGGGAGCAGGGGCAGG + Intronic
1049708297 8:144052664-144052686 GACCCCACGGGTGCTGGGGCGGG - Intronic
1049741328 8:144242440-144242462 GGCCCCCCGGGAGCTGGTGCTGG + Exonic
1049861267 8:144901093-144901115 GGGCCCAAGGGGGTAGGGGCGGG + Intronic
1049896088 9:113383-113405 GGTCCAAGGGGCGCGGGGGCCGG - Intergenic
1051367952 9:16334426-16334448 GGTCCCAAGGCTCCAGGGGCTGG + Intergenic
1052437085 9:28443658-28443680 GGGGCCAAGGTAGCAGGGGCTGG - Intronic
1052733678 9:32318613-32318635 AGGCCCAAGGTAGCAGGGGCAGG + Intergenic
1053013632 9:34649412-34649434 GCTCCCACAGGATCAGAGGCTGG + Exonic
1053135987 9:35650528-35650550 TGTCCCAGTGGACCAGGGGCCGG - Exonic
1054336344 9:63813366-63813388 GGTCAACCGGGAGCAGAGGCGGG - Intergenic
1057277537 9:93683981-93684003 GTTCCCACTGGAGCTGAGGCAGG + Intergenic
1059335524 9:113566301-113566323 GGAGCCAAGGGAGCAGGTGCAGG - Intronic
1060412337 9:123408103-123408125 TGGCCCAGGGTAGCAGGGGCTGG - Intronic
1060765676 9:126293697-126293719 GGCTCCCCGTGAGCAGGGGCTGG - Intergenic
1060993470 9:127862179-127862201 GGTCGCACAGCAGCAGGGGCAGG - Intergenic
1061094945 9:128451099-128451121 GTTCCCACAGTTGCAGGGGCTGG + Intergenic
1061296340 9:129678938-129678960 GGTCTCACGGCAGCTGGGCCAGG - Intronic
1061806676 9:133140910-133140932 AGTGCCACAGGAGGAGGGGCAGG - Intronic
1061913119 9:133735258-133735280 GGCCCCAAGGGAGCAGAGCCGGG - Intronic
1061918590 9:133769931-133769953 GGCCACACGGAATCAGGGGCAGG - Intronic
1062015300 9:134288231-134288253 GCTTCCTCTGGAGCAGGGGCAGG - Intergenic
1062025102 9:134336586-134336608 GGCCCCACGGGAAGAGGAGCAGG - Intronic
1062100449 9:134725229-134725251 GGTCCCCCAGCAGCTGGGGCAGG - Intronic
1062314778 9:135961279-135961301 CGGCCGACGGGAGCCGGGGCGGG - Exonic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1203369404 Un_KI270442v1:288717-288739 AGTCCAATGGGAGCAGAGGCAGG + Intergenic
1185432067 X:17276-17298 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1185441383 X:229990-230012 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1187900884 X:24025687-24025709 GGCGCCACGGGAGCGGGAGCGGG + Intronic
1189407102 X:40735309-40735331 GCTCCCGGGGGAGGAGGGGCTGG + Exonic
1191927478 X:66329168-66329190 GGTTCCAGGTGAGCATGGGCTGG + Intergenic
1193185606 X:78508281-78508303 CCTCCCACCGGAGCAGGTGCTGG + Intergenic
1194215358 X:91124227-91124249 GGTCCAAGGGGTACAGGGGCAGG - Intergenic
1194295724 X:92124211-92124233 GGTGCCACGGGAGCCAAGGCAGG + Intronic
1197061811 X:122190415-122190437 TGACCCCCGGGAGCAGTGGCAGG - Intergenic
1199606489 X:149583487-149583509 GGTCCCATGTGTGCTGGGGCAGG + Intronic
1199632633 X:149785881-149785903 GGTCCCATGTGTGCTGGGGCAGG - Intronic
1199974788 X:152887003-152887025 GGGCCCACAGCAGCAGGGGCTGG + Intergenic
1200039626 X:153355797-153355819 GGGCCCCCTGGAGCTGGGGCTGG - Intronic
1200051622 X:153435000-153435022 GGTCCACTGGGAGCACGGGCTGG - Intergenic
1200090882 X:153635420-153635442 GGACCCAAGCAAGCAGGGGCAGG + Intergenic
1200149159 X:153942992-153943014 GGGCCCCCTGGAGCTGGGGCCGG + Exonic
1200613228 Y:5348794-5348816 GGTGCCACGGGAGCCAAGGCAGG + Intronic