ID: 1062479287

View in Genome Browser
Species Human (GRCh38)
Location 9:136744031-136744053
Sequence GCTTTATTCTGAGCTGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 153}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062479279_1062479287 14 Left 1062479279 9:136743994-136744016 CCCCCAGTCAAAAGCATCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG 0: 1
1: 0
2: 2
3: 15
4: 153
1062479281_1062479287 13 Left 1062479281 9:136743995-136744017 CCCCAGTCAAAAGCATCCTTGGT 0: 1
1: 0
2: 0
3: 9
4: 214
Right 1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG 0: 1
1: 0
2: 2
3: 15
4: 153
1062479282_1062479287 12 Left 1062479282 9:136743996-136744018 CCCAGTCAAAAGCATCCTTGGTT 0: 1
1: 0
2: 1
3: 6
4: 141
Right 1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG 0: 1
1: 0
2: 2
3: 15
4: 153
1062479276_1062479287 24 Left 1062479276 9:136743984-136744006 CCCCGGCTGGCCCCCAGTCAAAA 0: 1
1: 0
2: 2
3: 8
4: 147
Right 1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG 0: 1
1: 0
2: 2
3: 15
4: 153
1062479285_1062479287 -3 Left 1062479285 9:136744011-136744033 CCTTGGTTTGCTGTGGAATCGCT 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG 0: 1
1: 0
2: 2
3: 15
4: 153
1062479278_1062479287 22 Left 1062479278 9:136743986-136744008 CCGGCTGGCCCCCAGTCAAAAGC 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG 0: 1
1: 0
2: 2
3: 15
4: 153
1062479277_1062479287 23 Left 1062479277 9:136743985-136744007 CCCGGCTGGCCCCCAGTCAAAAG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG 0: 1
1: 0
2: 2
3: 15
4: 153
1062479283_1062479287 11 Left 1062479283 9:136743997-136744019 CCAGTCAAAAGCATCCTTGGTTT 0: 1
1: 0
2: 0
3: 10
4: 202
Right 1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG 0: 1
1: 0
2: 2
3: 15
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062479287 Original CRISPR GCTTTATTCTGAGCTGGTGC TGG Exonic
900858009 1:5201433-5201455 GCTGTATTCTGGGCTGTTGCAGG + Intergenic
900910606 1:5594498-5594520 GCTTTCTGATGAGCTGGAGCTGG - Intergenic
902957254 1:19934074-19934096 GCTTTTGCTTGAGCTGGTGCAGG + Intergenic
908803954 1:67910254-67910276 TCTTTATTGTGAGGTGGTGAGGG + Intergenic
909280838 1:73751087-73751109 CCTTCATTCTGAGCTGTTTCTGG + Intergenic
910519229 1:88099487-88099509 TCAATATTCTGAGCTGGTTCAGG - Intergenic
910526186 1:88181022-88181044 GCTTTCGTGTTAGCTGGTGCAGG - Intergenic
910527452 1:88197325-88197347 GCTGTATTTTGAGCTAGTCCAGG - Intergenic
910859657 1:91731349-91731371 CCTTTGTTCTGGGGTGGTGCTGG - Intronic
912554857 1:110508519-110508541 GCTTTCTCCTGAGCTGGAGAGGG + Intergenic
912843209 1:113057593-113057615 CCTTTACTCTGAGCTCCTGCAGG - Intergenic
913547314 1:119881976-119881998 ACTTTATTCTGAGCAGGTGATGG + Intergenic
913556892 1:119976363-119976385 ACTTTATTCCGAGCAGGTGATGG - Intronic
914914225 1:151808568-151808590 GCTTTATTCTGAGCTTTTTTGGG + Intronic
916830243 1:168483523-168483545 GCTTTATTTGGAGCTGGAGTGGG + Intergenic
917556958 1:176100545-176100567 GTTTTTTTCTGAGCTGCAGCTGG - Intronic
919074874 1:192800717-192800739 GCTTTATTCTGAGCTCTTGGTGG - Intergenic
919212838 1:194510517-194510539 GCTTTATTCATGGCTGGAGCTGG - Intergenic
924275822 1:242385721-242385743 GCTTTATTCTGAGATGATGAGGG + Intronic
1063135191 10:3210156-3210178 GCTTGATTTTGAGCTGGAACAGG - Intergenic
1065088519 10:22205057-22205079 GCTTCATTCTCTGCTTGTGCTGG - Intergenic
1065330583 10:24593347-24593369 TCTTAAATCTGTGCTGGTGCTGG + Intronic
1073382488 10:103090187-103090209 CCTTTATTCTGATCTGTTTCAGG - Exonic
1076536788 10:131183618-131183640 ACTGTATTCTGAGCTTGTTCTGG - Intronic
1076645378 10:131950522-131950544 GCTTGATTCTAAGCTGGCGGTGG - Intronic
1077347547 11:2070863-2070885 GCGATATCCTGAGCTGGGGCAGG - Intergenic
1079475329 11:20823836-20823858 GCTTTCTTCGGGGCAGGTGCAGG - Intronic
1080680160 11:34468272-34468294 TCTTTTCTCTGAGCAGGTGCGGG + Exonic
1081247197 11:40782324-40782346 CATTTATTCTGAGCTGCTTCAGG + Intronic
1081677150 11:44976894-44976916 GCTTCCTTCTCAGCTGGAGCAGG - Intergenic
1085666497 11:78419002-78419024 GCTTTAGTCTGAGGTTGTGTGGG - Intergenic
1088734627 11:112718617-112718639 GCTTCATCCAGAGCTGCTGCTGG + Intergenic
1089580940 11:119481726-119481748 GCTTATTTCTGGGCTGGTGAGGG + Intergenic
1089642599 11:119857673-119857695 GCTCTGCTCTGAGCTAGTGCAGG + Intergenic
1090236896 11:125154863-125154885 GCTGCATTCTGAGCTGGAGCAGG - Intergenic
1098624891 12:72653031-72653053 ACTGAATTCTGAGGTGGTGCTGG + Exonic
1100857880 12:98774225-98774247 GCCTTATGCAGAGCAGGTGCTGG + Intronic
1102026798 12:109718333-109718355 GCTCTTTTCTGAGCTTCTGCGGG + Intronic
1103358978 12:120342552-120342574 ACTTTGTTCTCAGCTGGTGGGGG + Exonic
1103885553 12:124197673-124197695 GCTTTATTGTTAGCTGGATCGGG + Intronic
1103885656 12:124198311-124198333 GCTTTATTGTTAGCTGGGTCAGG - Intronic
1104290252 12:127460017-127460039 GCTTGGCTCTGAGCTGGAGCTGG + Intergenic
1104515348 12:129420112-129420134 CCTTTCCTCTGAGCTGGTGTGGG - Intronic
1106287867 13:28333835-28333857 GGTTTCTTCTGAGCTCGTGCTGG + Intronic
1108454228 13:50597129-50597151 GCTCCACTGTGAGCTGGTGCAGG + Intronic
1108736765 13:53292309-53292331 TGTTTTTTCTGAGCTGGAGCTGG - Intergenic
1108791365 13:53972732-53972754 GCCATAGTCTGGGCTGGTGCTGG - Intergenic
1113734412 13:112667815-112667837 GCTTTATTCTGAAGGGGTGTTGG - Intronic
1116590731 14:46768867-46768889 ACTTTATTCTGGAATGGTGCTGG + Intergenic
1120980994 14:90288878-90288900 GCTCTATGCTGAGCTGGAGGTGG - Exonic
1121334657 14:93069864-93069886 GTTTTCTCCAGAGCTGGTGCTGG - Intronic
1124131013 15:26985655-26985677 GCATTTTTCTGAGCTGGTCTTGG + Intronic
1125328555 15:38561704-38561726 GCTCTATTCTGACCTGATGCAGG + Intronic
1128434851 15:67636717-67636739 ACTTTATTCTGAGATTGTGGTGG + Intronic
1135907358 16:26525183-26525205 CATTCCTTCTGAGCTGGTGCTGG + Intergenic
1138389796 16:56662227-56662249 GCTTGACTCTGAGCTGGCGCAGG + Intronic
1139594959 16:67952056-67952078 GCTTTGACCTGAGCAGGTGCCGG - Intronic
1139776574 16:69320346-69320368 GCTTTATTCTGAGCTGCGGCTGG + Intronic
1141234511 16:82203156-82203178 GCTTTATGCTGACCTTGTCCTGG + Intergenic
1141706336 16:85667231-85667253 GCCTTATTCTGACCTTGTCCTGG + Intronic
1142130377 16:88429317-88429339 GCTTTCCTCTGAGCTGGGGTTGG - Exonic
1142473116 17:174116-174138 CCTTTATTCTGAGCTGGTGATGG + Intronic
1143618425 17:8067360-8067382 GCATTGTTCTGAGATGGTGAGGG + Intergenic
1144575854 17:16428889-16428911 GCTTGTGTCTGCGCTGGTGCTGG + Exonic
1146131082 17:30275730-30275752 TCTTTATTCTGTCCTTGTGCAGG - Intronic
1146223623 17:31047952-31047974 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1146833450 17:36090055-36090077 GCATGATTCTGAGCAGGTGACGG + Exonic
1147232781 17:39031212-39031234 GCTTGATCCTGACCTGGTGTTGG - Intergenic
1147232814 17:39031404-39031426 GCTTGATCCTGACCTGGTGTTGG - Intergenic
1147302468 17:39540876-39540898 GCCTTGTTCTGATCTGCTGCAGG - Intronic
1147922003 17:43923426-43923448 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1148173985 17:45548543-45548565 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1148275282 17:46296904-46296926 GCTTGATCCTGACCTGGTGTTGG - Exonic
1148297388 17:46514483-46514505 GCTTGATCCTGACCTGGTGTTGG - Exonic
1148361942 17:47018963-47018985 GCTTGATCCTGACCTGGTGTTGG - Intronic
1149521144 17:57319069-57319091 GCTCTCTTCTGAGCTGGTGATGG + Intronic
1150405199 17:64895465-64895487 GCTTGATCCTGACCTGGTGTTGG + Exonic
1150784229 17:68150071-68150093 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1150784285 17:68150428-68150450 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1151399054 17:73843705-73843727 GCTGGATTCTGAGCTGGGACTGG + Intergenic
1152158639 17:78652682-78652704 GCTTTATTCTTGGCTAGGGCAGG + Intergenic
1152875102 17:82781904-82781926 GCTGGTTTCTGCGCTGGTGCTGG + Intronic
1156490062 18:37490885-37490907 ACTCCATTATGAGCTGGTGCCGG - Intronic
1157991783 18:52504982-52505004 GCTTTATTCTGAGCTTTTCTAGG - Intronic
1161768163 19:6217994-6218016 GCTGGAGTCTGAGCTGGAGCTGG + Exonic
1163733237 19:18962286-18962308 GCTTTATTCTGAGGCTGTGGGGG - Intergenic
1166853997 19:45773362-45773384 GCTTGATTCTGAACCGCTGCGGG - Intronic
1168473167 19:56657609-56657631 GCTTTATTTACAGCTGGTTCTGG + Intergenic
925118272 2:1398458-1398480 CTTTGCTTCTGAGCTGGTGCCGG - Intronic
925896936 2:8479647-8479669 GCTCCCATCTGAGCTGGTGCTGG - Intergenic
925909552 2:8564670-8564692 GCTTCATGCTGAGCACGTGCTGG - Intergenic
926588912 2:14718950-14718972 GCTTGAGTGTGAGATGGTGCAGG + Intergenic
932199339 2:69812008-69812030 GCCTTCTTGTGAGCTGGTGTTGG + Intronic
937077943 2:119120729-119120751 GGTCTATTCTGAGCTGGGGAGGG + Intergenic
942720052 2:178941275-178941297 GCTTTATTCTGGGGTGATCCAGG - Intronic
943257666 2:185616837-185616859 GCTTTATGCTGAGCACGTGTTGG + Intergenic
1169361272 20:4951317-4951339 GCTTACTTCTGAGTTAGTGCTGG - Intronic
1178077351 21:29024268-29024290 TTTTTATTCTGACATGGTGCAGG + Intergenic
1179044852 21:37834890-37834912 GCTTTATTCTGAGTAGCTCCAGG - Intronic
1181733396 22:24863701-24863723 GTTTTTGTCTGAGCTTGTGCAGG + Intronic
1182116140 22:27757616-27757638 CCTTTATTTGGACCTGGTGCGGG + Intronic
1184243702 22:43224959-43224981 ACGTTATTCTAAGCTGGTGGTGG - Intronic
1185080091 22:48704935-48704957 GCTGTGTCCTGAGATGGTGCAGG + Intronic
1185330170 22:50248869-50248891 GTTTGACCCTGAGCTGGTGCTGG - Exonic
950202590 3:11055594-11055616 TCTTTCCTCTGAGCTGGGGCTGG - Intergenic
953469007 3:43150925-43150947 GCTTTATTCTTGCCTAGTGCAGG - Intergenic
955722187 3:61894340-61894362 GCTTTTATCTTATCTGGTGCTGG + Intronic
956554111 3:70498734-70498756 GCTTTATGCTGTCCTGGTTCAGG - Intergenic
958106338 3:89078480-89078502 GCTTTATTTTGAGCTTTTTCTGG + Intergenic
960210174 3:114955125-114955147 GGTTTATCCTGAGTTGGTGAAGG - Intronic
960578029 3:119246251-119246273 GCTAGGCTCTGAGCTGGTGCTGG - Intergenic
960936787 3:122909474-122909496 CCTTTAATCTGGGCTGGTACAGG - Exonic
962416091 3:135183380-135183402 GCTCTATATTTAGCTGGTGCAGG - Intronic
962812001 3:138967281-138967303 GGTTGCTTCTGAGCAGGTGCAGG - Intergenic
964417274 3:156460562-156460584 GCTTAATTCTGTACTCGTGCTGG - Intronic
966338625 3:178900149-178900171 CCTTCATTCTGAGCTGCTACAGG - Intergenic
968160127 3:196419803-196419825 GATTTATTCTGTGATGGTTCTGG - Intronic
969323208 4:6425494-6425516 GGCTGATTCTGAGCTCGTGCTGG - Intronic
970910129 4:21265210-21265232 GCTTTTGCCTGTGCTGGTGCTGG - Intronic
973947540 4:55974092-55974114 ACTGTATCCTTAGCTGGTGCTGG + Intronic
977753382 4:100635661-100635683 GCTCTCCTCTGAGCTGGGGCAGG - Intronic
978237435 4:106476018-106476040 CGTTTACTCTGTGCTGGTGCTGG + Intergenic
981190554 4:141857345-141857367 GCTTCACTCTGTGCTGGGGCTGG + Intergenic
983742733 4:171155368-171155390 GCAGAGTTCTGAGCTGGTGCAGG - Intergenic
984123131 4:175770947-175770969 GTTTTATTCTCAGAAGGTGCAGG - Intronic
985026076 4:185740742-185740764 GCGTTGGGCTGAGCTGGTGCTGG - Intronic
991564765 5:67993412-67993434 GCTCTCTTCTGAGCTGGAGATGG + Intergenic
992088889 5:73300793-73300815 GCTTTGCTCTGAGCTGCGGCGGG + Intergenic
994423499 5:99553958-99553980 ACTTTATTCTGAGGTGGTCATGG + Intergenic
997856075 5:137373781-137373803 GTTTGATTCTGAGCTCCTGCTGG - Intronic
998172728 5:139881979-139882001 GCTTTATCCAGAGCTCATGCTGG - Intronic
1002210614 5:177596778-177596800 GCTTAATACTGAGCAGGTGGTGG + Intergenic
1003330739 6:5126298-5126320 GCATTATACTCAGTTGGTGCTGG - Intronic
1006273233 6:32980642-32980664 GCTGGAATCTGAGCTGGAGCTGG - Exonic
1015847120 6:137532359-137532381 CCTTTACTCTGAGATGGTGCGGG + Intergenic
1018378024 6:163231912-163231934 GCTTCACTCTCAGCTGGAGCTGG + Intronic
1018603819 6:165576877-165576899 GATTTATTCTGAGCTGGAGATGG - Intronic
1018986025 6:168637904-168637926 GCTGTATGCTGAGCTGGAGCTGG + Intronic
1018986027 6:168637922-168637944 GCTGGATGCTGAGCTGGAGCTGG + Intronic
1023121334 7:36911925-36911947 GCTGTATTCTCAGCTGGGCCTGG - Intronic
1027688379 7:81307391-81307413 GTTCTATTTTAAGCTGGTGCTGG - Intergenic
1031688083 7:124757029-124757051 GATTTATTCTGAGCTCCTGAGGG - Intronic
1035078624 7:156198223-156198245 GCTTTATTCTGTTCCGGTGTTGG - Intergenic
1035403401 7:158583414-158583436 GCTTTACTCCGAGATGGTGTTGG - Intronic
1035647275 8:1234315-1234337 GCTTTCTTCTGAGCCTGTGAGGG + Intergenic
1039688280 8:39832474-39832496 ACTTTATTCTCATCTGATGCAGG + Intronic
1040713853 8:50223090-50223112 GTTTTATTTTGAGTTGGTCCTGG - Intronic
1040867929 8:52069772-52069794 ACCTTATCCTGTGCTGGTGCTGG + Intergenic
1041667925 8:60463910-60463932 GCTTTATTCTGGGGTGGTGAAGG + Intergenic
1042607122 8:70556657-70556679 TCTTTATTCTGGCCTGGCGCAGG + Intergenic
1043546154 8:81318056-81318078 GCTTGACTCTGAGCTGAGGCTGG + Intergenic
1045417930 8:101985346-101985368 TCTCTAATCTGAGCTGGTCCAGG - Intronic
1047488333 8:125353228-125353250 CATTTATTCTGAACTGATGCTGG - Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1053089287 9:35259114-35259136 GGGTTATTCTGAGCTGGGGAGGG + Intronic
1057216399 9:93231184-93231206 GTTTTGTTCAGACCTGGTGCAGG + Intronic
1058355413 9:104078317-104078339 CGTTTATTCTGAGCTGCAGCTGG + Intergenic
1059353403 9:113681930-113681952 GCTCAATTCTGAGCTCGTGAAGG - Intergenic
1059923083 9:119179438-119179460 GCTTTATTCAGAGCCAGTGTGGG - Intronic
1061279733 9:129590652-129590674 GTTTTATTCTGAGTTGGTGGGGG + Intergenic
1062476493 9:136730180-136730202 TCTACCTTCTGAGCTGGTGCAGG + Intergenic
1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG + Exonic
1062481453 9:136754396-136754418 AGTTTATTCAGAGCAGGTGCAGG + Exonic
1191616034 X:63169836-63169858 GCTTTATTCTGAGCGCTTTCAGG - Intergenic
1191620264 X:63209087-63209109 GCTTTATTCTGAGCGCTTTCAGG + Intergenic
1193436383 X:81479056-81479078 GCTGCAATCTAAGCTGGTGCTGG - Intergenic
1194983844 X:100468685-100468707 GCTTTACTCTGTGCTGCTGCTGG - Intergenic
1197199536 X:123735849-123735871 GCTGTATTCAGAACTGGTTCTGG + Intergenic
1198520599 X:137448772-137448794 GCATTATGCTGCTCTGGTGCTGG + Intergenic
1200090918 X:153635579-153635601 GGTTTCTCCTGAGCTGCTGCCGG - Intergenic
1201051221 Y:9937580-9937602 GTATTATTCTGAGTTGGTGGTGG - Intergenic