ID: 1062479572

View in Genome Browser
Species Human (GRCh38)
Location 9:136745063-136745085
Sequence GGGCCGCTTGGGGGCCGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062479572_1062479581 3 Left 1062479572 9:136745063-136745085 CCCACGCGGCCCCCAAGCGGCCC 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1062479581 9:136745089-136745111 CACCACACAGCTCCCAACGTGGG 0: 1
1: 1
2: 0
3: 10
4: 105
1062479572_1062479580 2 Left 1062479572 9:136745063-136745085 CCCACGCGGCCCCCAAGCGGCCC 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1062479580 9:136745088-136745110 GCACCACACAGCTCCCAACGTGG 0: 1
1: 1
2: 1
3: 13
4: 108
1062479572_1062479583 13 Left 1062479572 9:136745063-136745085 CCCACGCGGCCCCCAAGCGGCCC 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1062479583 9:136745099-136745121 CTCCCAACGTGGGCCCCGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062479572 Original CRISPR GGGCCGCTTGGGGGCCGCGT GGG (reversed) Intronic
900119265 1:1041635-1041657 GGGCCGATCGGGGGCCGCCCGGG + Exonic
900291006 1:1923591-1923613 GGACGGCCTGGGGGCCCCGTGGG + Intronic
901443481 1:9293166-9293188 GCGCCGCTGGGGGACCGAGTGGG + Intronic
901641116 1:10693758-10693780 GGGCCGGGTGGGGGCCGGGAGGG - Intronic
902608146 1:17580679-17580701 GGGCCGCTGGGGGCCGGCGGAGG + Intronic
905168704 1:36098146-36098168 GGGACCCCTGGGGGCCCCGTGGG + Exonic
906640266 1:47437393-47437415 GGGCCGCGCTGGGGCGGCGTGGG + Exonic
912471492 1:109910263-109910285 GGGCTGCTTGGGGGCTGCAGAGG + Intronic
914702835 1:150149988-150150010 GGGCCGCGTGGGCGCCGGGATGG + Exonic
917869524 1:179229372-179229394 GGGCAGCAGGTGGGCCGCGTCGG - Exonic
922917708 1:229271535-229271557 GGGCCGCTGGGGGCTCGGGTGGG + Intronic
923506285 1:234609173-234609195 GGGCCGCCTCGGGGCCGCCGTGG + Exonic
1065022295 10:21510293-21510315 GGCCGGCTTGGGGGCCGCAGGGG - Intergenic
1067300192 10:45001000-45001022 GGGGCGCTCGGGGCCTGCGTCGG + Intronic
1074756521 10:116627841-116627863 AGGAGGCTGGGGGGCCGCGTGGG + Exonic
1075874171 10:125792907-125792929 GGACTGCTTGGGGGCCACGAAGG - Intronic
1077101003 11:822304-822326 GGGGCCCTTGGTGGCCGGGTGGG + Intronic
1083270113 11:61567896-61567918 TGGCCGCTTTGGGGCTGCCTGGG + Intronic
1083681410 11:64353503-64353525 GGGCCGCCTGGGAGCGGGGTGGG + Intronic
1090788567 11:130070340-130070362 GGGCGGGTTGGGGGCTGGGTCGG - Intronic
1095049113 12:37541478-37541500 GGTCCCGTTTGGGGCCGCGTGGG - Intergenic
1096784434 12:54009119-54009141 GGGCAGGTTGGGGGGCGCCTCGG - Exonic
1097192336 12:57225460-57225482 GGGCCGCTTGGGGGCGCGTTGGG + Exonic
1098541613 12:71663718-71663740 AGGCCGCTTGGTGTCCGAGTAGG - Exonic
1099956201 12:89354009-89354031 TGGCCGGGTGGGGGCCGCGGCGG + Intergenic
1101772144 12:107761204-107761226 GCGCCGCTTGCGGGCCGCGGCGG - Intronic
1103474776 12:121210308-121210330 GGGCCGCGCGGGGGGCGCGGCGG + Intronic
1110597022 13:77329917-77329939 GGGGGGCGTGGGGGCCGCCTGGG + Intergenic
1113849093 13:113407879-113407901 GGGCCGGGTGGGGGCCTCGTGGG - Intergenic
1113849133 13:113408004-113408026 GGGCCGCTGGGTGGCCTCCTGGG + Intergenic
1114269602 14:21092643-21092665 GGGACGCTCGGGAGCCCCGTGGG + Exonic
1118302106 14:64625276-64625298 GGGTCACTTGGGGCCAGCGTGGG - Intergenic
1119539243 14:75428045-75428067 GGGACGCTCGGCGGCCGCGACGG + Intronic
1122220767 14:100238357-100238379 GGGCGGCCCGGGGGCCGCGCGGG - Intronic
1122884843 14:104706373-104706395 GGGCAGCCTGGGGGCCGGGCTGG + Intronic
1123036720 14:105474694-105474716 GGGCCGCCTGGGGGCGCCGCGGG - Intronic
1124743136 15:32315379-32315401 GGGCGGCCTCGGGGCCGCGCCGG - Intergenic
1129051209 15:72783508-72783530 GGGCCGGTTGGCGGCAGCCTGGG - Exonic
1130115718 15:81002577-81002599 GGGCCGCTTCGGGGAGGCGGGGG + Exonic
1131250511 15:90827239-90827261 GGGACACTTGGGGGCCGCTGTGG + Intergenic
1132110809 15:99100604-99100626 GGGCGGCTCTGGGGCCGCCTCGG - Intronic
1132365137 15:101251599-101251621 GGGCGGCTCGGGGGCCGCGATGG - Exonic
1132641955 16:982048-982070 GGGCCGCGCGGGGGTCGCGGTGG + Exonic
1132878034 16:2148896-2148918 GGGCCCGTTGGGCGGCGCGTCGG - Exonic
1134588620 16:15434419-15434441 GGGAGGCTTGGGGGCTGGGTAGG - Exonic
1136568024 16:31081498-31081520 GTGGCGCTTGGGGTCCGTGTGGG - Exonic
1137671510 16:50282104-50282126 GGGCTGCTTTGGGGCCCTGTTGG - Intronic
1139852644 16:69960300-69960322 AGGCCTCTGGGGGGCAGCGTGGG + Intronic
1139881615 16:70183208-70183230 AGGCCTCTGGGGGGCAGCGTGGG + Intronic
1140370893 16:74412297-74412319 AGGCCTCTGGGGGGCAGCGTGGG - Intronic
1141945331 16:87305497-87305519 GGGCAGCCTGGGGGCGGCGGGGG - Intronic
1142144784 16:88488281-88488303 GGGCCGCATGGGGGCGGGGGTGG + Intronic
1142876490 17:2854310-2854332 GGGCCGCTGGGAGGGCGCATCGG + Intronic
1143500433 17:7335633-7335655 GGGCTGGTTGGGGGCGGAGTGGG + Intergenic
1143537394 17:7549367-7549389 GGGGCCGCTGGGGGCCGCGTGGG + Intronic
1143750223 17:9022057-9022079 GGGCGGCGTGGGGGCGGCGGTGG + Intronic
1145303628 17:21657183-21657205 GGGCAGCATGGTGGCCGCGATGG - Intergenic
1145378996 17:22376825-22376847 GGTCCAGTTTGGGGCCGCGTGGG - Intergenic
1145379474 17:22379195-22379217 GGTCCAGTTTGGGGCCGCGTGGG - Intergenic
1145379953 17:22381565-22381587 GGTCCAGTTTGGGGCCGCGTGGG - Intergenic
1145380433 17:22383940-22383962 GGTCCAGTTTGGGGCCGCGTGGG - Intergenic
1145380911 17:22386287-22386309 GGTCCAGTTTGGGGCCGCGTGGG - Intergenic
1145381391 17:22388662-22388684 GGTCCAGTTTGGGGCCGCGTGGG - Intergenic
1145382124 17:22392436-22392458 GGTCCAGTTTGGGGCCGCGTGGG - Intergenic
1145382599 17:22394801-22394823 GGTCCAGTTTGGGGCCGCGTGGG - Intergenic
1145382879 17:22396164-22396186 GGTCCAGTTTGGGGCCGCGTGGG - Intergenic
1145383452 17:22398987-22399009 GGTCCAGTTTGGGGCCGCGTGGG - Intergenic
1145383966 17:22401455-22401477 GGTCCAGTTTGGGGCCGCGTGGG - Intergenic
1145384404 17:22403657-22403679 GGTCCAGTTTGGGGCCGCGTGGG - Intergenic
1145384723 17:22405119-22405141 GGTCCAGTTTGGGGCCGCGTGGG - Intergenic
1145754587 17:27381260-27381282 GAGCCTCTTGGGGGCCTCTTGGG + Intergenic
1147567957 17:41549019-41549041 GCGCCTCCTGGGGGCCGCGAGGG + Intergenic
1148552727 17:48560146-48560168 GGGCAGCTTGGGGGCTGCAGGGG + Intronic
1148786982 17:50150379-50150401 GGCCCCCTTGGGTGCCTCGTCGG + Exonic
1152768360 17:82152887-82152909 GGGACGCTCGGGGGCCGCGGGGG + Intronic
1152858546 17:82680366-82680388 GGGCCGCTCGGGGGACGGGACGG + Intronic
1153051880 18:907981-908003 GGGCCGCGTGGGGACCGAGGGGG + Intronic
1154169213 18:12038638-12038660 GGGCCGCCCGGGGGCGGCCTGGG - Intergenic
1160789496 19:917103-917125 GGGCCGCGTGGAGGCCGCTGTGG - Intergenic
1160909798 19:1469191-1469213 GGGGCGCGCGGGGGCCGCCTGGG + Exonic
1161331866 19:3692390-3692412 GGGCAGCATGGGGGCCGCCGGGG - Intronic
1161397835 19:4054230-4054252 GGGCCGGGCGGGGGCCGCGGCGG - Exonic
1162499937 19:11047246-11047268 GGGCCTCTTGGGGGCCAAGGTGG + Intronic
1162555773 19:11384433-11384455 AGGCCGCTTGGGGGCAGGGGAGG + Intronic
1163426936 19:17245294-17245316 GGGCCGAATGCGCGCCGCGTAGG - Exonic
1163722118 19:18903294-18903316 GGGCCGCTGGGAGGCCGCTGAGG - Exonic
1165080384 19:33303025-33303047 GGGCCGGTGGGGGGCCGTTTGGG + Intergenic
1165856345 19:38881024-38881046 GGGCCCCATGGGGGCAGCCTGGG - Intronic
1166061553 19:40328702-40328724 GGGATGCTTGGGGGCAGGGTGGG + Intronic
1167091806 19:47349411-47349433 GGGCCGCTTGGGGGTAGTTTGGG + Intronic
1167125449 19:47545550-47545572 GGGCCGCGTGGGGGCCGGCTGGG + Exonic
1167175354 19:47860722-47860744 GAGCCGCTCGGGGGCGGCGCCGG - Intergenic
1167455644 19:49595770-49595792 GGGCCGCTGGGGGGCTGTGGGGG - Exonic
928303614 2:30147622-30147644 GGGCCGCTTGGGCCGGGCGTGGG - Intronic
935237582 2:101151425-101151447 GGGCCACGTGAGGGCCGCGCTGG - Intronic
947669344 2:231926504-231926526 GGGCCGGGAGGGGGCCGCGGGGG + Intergenic
947793937 2:232882698-232882720 GGGCAGCTTCGGGGCCACGACGG + Intronic
1171521146 20:25774868-25774890 GGGCAGCATGGTGGCCGCGATGG - Exonic
1171543647 20:25984981-25985003 GGTCCCGTTTGGGGCCGCGTGGG - Intergenic
1174386648 20:50191459-50191481 GGGGCGCCTGGGGGCCGCCAAGG + Exonic
1175928944 20:62484587-62484609 GGGACCCTTGGGGGCCACCTGGG + Intergenic
1176550002 21:8216977-8216999 GCGCCGCGTGGGGGCGGCGGCGG + Intergenic
1176568928 21:8400011-8400033 GCGCCGCGTGGGGGCGGCGGCGG + Intergenic
1176576842 21:8444246-8444268 GCGCCGCGTGGGGGCGGCGGCGG + Intergenic
1178544154 21:33479577-33479599 GGGCTGCTTGCGGGTCGCGGCGG + Intronic
1179318845 21:40270747-40270769 GGGCAGCTTGGGGGCCGCTTGGG + Intronic
1179318849 21:40270758-40270780 GGGCCGCTTGGGGGCAGCTTGGG + Intronic
1179923727 21:44521439-44521461 GGGCAGCGTGGGGGCCGGGTCGG - Intronic
1179999394 21:44988195-44988217 AGGCCGCTTGGGTGCCCCCTCGG - Intergenic
1180560343 22:16610102-16610124 GGGCGCCTTGGGGGCGGCGCGGG + Intergenic
1180960649 22:19760924-19760946 GAGCAGCCTGGGGGCCGCGGGGG + Exonic
1184416219 22:44353201-44353223 GGGGCGATTGGGGGCCACCTGGG - Intergenic
1184659572 22:45959735-45959757 GGGCTGCTTGGGTGCCAGGTTGG - Intronic
1185285785 22:49999517-49999539 GGGCGGCTGAGGGGCCGCGCGGG + Intronic
1185409070 22:50673337-50673359 GGGCTGCTTGGGGGCGGAGGAGG + Intergenic
1203254892 22_KI270733v1_random:133303-133325 GCGCCGCGTGGGGGCGGCGGCGG + Intergenic
1203262948 22_KI270733v1_random:178382-178404 GCGCCGCGTGGGGGCGGCGGCGG + Intergenic
950024225 3:9809812-9809834 GGGCTGGTTGGGGGCTGCGATGG - Intronic
969114079 4:4860401-4860423 GGGCCGGGTGGGGGCCGGGTGGG + Intronic
972245908 4:37245078-37245100 GGGCAGCTTGGTGCCCGCGCCGG - Exonic
973279239 4:48341835-48341857 GAGCCGCTCGGGGGCCGTGCAGG + Exonic
976092436 4:81472020-81472042 GGGCCGGGTGGCGGCGGCGTGGG - Intronic
985512447 5:320471-320493 TGGCCACTTGGGGGCAGGGTGGG + Intronic
989133934 5:38134837-38134859 GAGGCCCTTGGGGTCCGCGTGGG + Intergenic
999277202 5:150339152-150339174 GGGCAGCTTGGGAGCTGTGTGGG - Intronic
1000351288 5:160354861-160354883 GGGCTCCTGGGGGGCCGGGTGGG + Exonic
1001345750 5:170896887-170896909 GGGGCGCTTGTGAGCCGCGCCGG - Intronic
1003158539 6:3616791-3616813 GGGCAGCTTGGGGGCCTCCATGG - Intergenic
1011117066 6:83905694-83905716 GGGCCTCTTGGTGGCCTAGTTGG + Intronic
1017810790 6:157981991-157982013 GGGGCGCCTGGGGGCCGAGGGGG + Exonic
1019348622 7:542869-542891 GGCCTGCTTGGGGGCCACGAAGG - Intergenic
1020274377 7:6615704-6615726 GGGCCGCGCGGGGGCCGGGGCGG - Exonic
1020281968 7:6654463-6654485 CGGCCCCTTGGCGGCCGCCTCGG - Exonic
1020283726 7:6664356-6664378 GGGCCGCCTGGCTGCCGCCTGGG + Intergenic
1020727291 7:11831887-11831909 GGGGCGCTGCGGGGCCGCGCCGG - Exonic
1025281624 7:57629811-57629833 GGGCAGCATGGTGGCCGCGATGG - Intergenic
1025295019 7:57770051-57770073 GGTCCCGTTTGGGGCCGCGTGGG - Intergenic
1025303106 7:57835704-57835726 GGGCAGCATGGTGGCCGCGATGG + Intergenic
1025715224 7:63949909-63949931 GGGCCACTTGGTGGCAGTGTGGG + Intergenic
1034349162 7:150405331-150405353 GGGCCGCGCTGGGGCCGCGGCGG + Intronic
1034434477 7:151056854-151056876 TGGCCGCTTGGGGGAGGCGGGGG - Intronic
1035225060 7:157428252-157428274 GAGCCGCGTGGGAGCCTCGTGGG + Intergenic
1037778051 8:21848725-21848747 GAGCCCTTTGGGGGCAGCGTGGG - Intergenic
1041384153 8:57280474-57280496 GGGCCGGATGGGGGCCGGGTGGG + Intergenic
1041739182 8:61140029-61140051 GGGCAGCTTGGGGTCCGTGGCGG - Intronic
1049005863 8:139855315-139855337 GGGCTGCGTGGGAGCAGCGTGGG - Intronic
1056396581 9:86186838-86186860 GGGCTGCATGGGGGCAGGGTGGG + Intergenic
1057259670 9:93576680-93576702 GGGCCGCGCGGGGGCGGCGGGGG - Exonic
1058505415 9:105661373-105661395 GGGCCTCTTTGGGGCTGCATTGG - Intergenic
1061194778 9:129101860-129101882 GTGCCTCTTGGGGGCCGTGCTGG - Intronic
1061264130 9:129495955-129495977 AAGCCGCTTGGGGGCCGCGGAGG + Intergenic
1062005443 9:134236426-134236448 GGGCAGGTTGGGGGCAGGGTGGG + Intergenic
1062479537 9:136744947-136744969 GGGCCGCTCGGGGGCCATGTGGG - Intronic
1062479560 9:136745024-136745046 GGGCCGCTCGGGGGCCATGTGGG - Intronic
1062479572 9:136745063-136745085 GGGCCGCTTGGGGGCCGCGTGGG - Intronic
1062479585 9:136745102-136745124 GGGCCACTCGGGGCCCACGTTGG - Intronic
1062499472 9:136846099-136846121 GGGGCCGTCGGGGGCCGCGTGGG - Exonic
1062646809 9:137551943-137551965 GGGCCGCTTGGAGCTCGTGTGGG + Exonic
1203794553 EBV:169688-169710 GGGGGGCTGGGGGGCCGCGGGGG - Intergenic
1203794754 EBV:170226-170248 GGGGGGCTGGGGGGCCGCGGGGG - Intergenic
1203794945 EBV:170749-170771 GGGGGGCTGGGGGGCCGCGGGGG - Intergenic
1203795146 EBV:171287-171309 GGGGGGCTGGGGGGCCGCGGGGG - Intergenic
1203471293 Un_GL000220v1:116448-116470 GCGCCGCGTGGGGGCGGCGGCGG + Intergenic
1203479114 Un_GL000220v1:160420-160442 GCGCCGCGTGGGGGCGGCGGCGG + Intergenic
1186480993 X:9895888-9895910 CGGCCGCTGGAGGGCCGGGTTGG + Exonic
1197500233 X:127232476-127232498 GGGCGGCATGGGAGCCGAGTGGG - Intergenic
1199975609 X:152893417-152893439 GGGCCCCTGGGGGGCGGGGTTGG + Intergenic