ID: 1062480324

View in Genome Browser
Species Human (GRCh38)
Location 9:136748036-136748058
Sequence CTGTAGAACTGGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 329}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062480324 Original CRISPR CTGTAGAACTGGAGGCTGGA GGG (reversed) Intronic
900407782 1:2500022-2500044 CTGTAGGGGTGGAGGCTGCAAGG - Intronic
901209480 1:7516371-7516393 CTGTGGAATTGGGGGCTGGGAGG + Intronic
901213652 1:7540993-7541015 CTGGAGAACTGGAGGTTGCAGGG + Intronic
902147861 1:14418896-14418918 CTGCAGAAATGATGGCTGGATGG + Intergenic
902407294 1:16191734-16191756 CTGAAGGACTGGAGACTGGCTGG + Intergenic
903183264 1:21615703-21615725 CTGAAGAAGTGCAGACTGGAGGG - Intronic
903376656 1:22870602-22870624 CTGCAGACCTGGGGGCTGGGAGG + Intronic
903670243 1:25031156-25031178 CTGGAGAGATGGAGACTGGAGGG + Intergenic
903670328 1:25031477-25031499 CTGGAGGGATGGAGGCTGGAGGG + Intergenic
906190077 1:43893243-43893265 CTGAATAACTGGAGGCTGCAGGG - Intronic
906690728 1:47791228-47791250 CTGTGGTTCTGGAGTCTGGATGG - Intronic
907454716 1:54567931-54567953 GGGAAGAACTGGAGGCTGTAGGG - Intronic
907593095 1:55694376-55694398 CTGTAGAGTGGGAGGTTGGATGG + Intergenic
907911804 1:58833729-58833751 CTGTAAAAGTGGAGGCAGGAAGG + Intergenic
908640928 1:66222505-66222527 ATGAACAACTGGAGGCTGCATGG - Intronic
908796840 1:67838546-67838568 CTGTATATCTGGAGGCTAGATGG - Intergenic
910247423 1:85154774-85154796 CTGCAAAACTGGATGCTTGAAGG + Intergenic
911509434 1:98792794-98792816 CTCTAGATCTTAAGGCTGGAAGG + Intergenic
912080955 1:105935064-105935086 CTGTAGAGCTGCAGGCTGAGAGG + Intergenic
912453044 1:109779078-109779100 CTGTAGATCTGGAGTCTGGTGGG + Intergenic
912856349 1:113171566-113171588 CTGCAGACCTGGAGACTAGATGG + Intergenic
916211169 1:162361007-162361029 GTGTAGAGCTGGAGGGTGCAGGG + Intronic
916275346 1:162988006-162988028 CTCTAGACCTGGAGACTGAATGG + Intergenic
916940920 1:169677065-169677087 CTGTAGAATTTTAGGCTGGCAGG + Intronic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
918589206 1:186221996-186222018 CTTTAGGACTGCAGGCTGCATGG + Intergenic
919520612 1:198582930-198582952 CTTTAGGACTGCAGGCTGCATGG - Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920839131 1:209539126-209539148 CTGTAGAAGTGAAGTCTGGCTGG + Intergenic
923537239 1:234862722-234862744 CTGTAGCACTGAGGGCTGGAGGG - Intergenic
1062800476 10:375760-375782 CCCTAGAACTGGAGGCTGTGAGG - Intronic
1062824538 10:557945-557967 CTGGAGGGCTGGAGGCAGGAGGG + Intronic
1063430480 10:5984223-5984245 TCGTAGTTCTGGAGGCTGGAAGG + Intergenic
1063547423 10:6995248-6995270 CTGTAGATCTGAAGACTGAATGG + Intergenic
1064271609 10:13870959-13870981 TTGTGGAACAGAAGGCTGGATGG - Intronic
1065324748 10:24540800-24540822 CTGTCGCCCGGGAGGCTGGAGGG + Intronic
1067211193 10:44261413-44261435 CTGAAGCACTGGAGCCTGGGCGG + Intergenic
1069571142 10:69495124-69495146 CTGTAAAACAAGAGGCTGGATGG + Intronic
1071191471 10:83106632-83106654 CTATAGAACTGGAAGCTAGAAGG + Intergenic
1071701841 10:87947001-87947023 CTGTAGGAAAGGGGGCTGGAAGG + Intronic
1073563764 10:104518545-104518567 CAGGAGAACTGGGGGCTGTAAGG + Intergenic
1073568402 10:104555340-104555362 CTACAGAACTGGAAGCTGGAGGG - Intergenic
1073599432 10:104832404-104832426 CTATTGAACTGGAAGCTGAAAGG - Intronic
1073652432 10:105375848-105375870 GAGTAGAAGTGGAGGTTGGAAGG - Intergenic
1074938641 10:118212921-118212943 CTGTAAAACTGGAGGTTGTAAGG - Intergenic
1074949156 10:118312046-118312068 GTGTAAAACTGAAAGCTGGAGGG - Intronic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075412371 10:122238276-122238298 TTGTGGAACTGGAGGCTGAGTGG - Intronic
1075532032 10:123237784-123237806 CTGTAGAACTGGATGCTTGCTGG + Intergenic
1075798684 10:125138753-125138775 CTGTAGTTCTGGAGCCTGAAAGG - Intronic
1075940167 10:126384789-126384811 CTGAAGAACTGGTGGTTGGTGGG - Intronic
1077327852 11:1971425-1971447 CTGTGGAGCAGGACGCTGGAGGG - Intronic
1077365911 11:2161530-2161552 CAGGAGAGCTGGAGGCTGCAGGG + Intergenic
1077501174 11:2910391-2910413 AAGTAGAACTGGGGGCTCGATGG + Intronic
1077741617 11:4852422-4852444 GTGAAGAACTGTAGGCTGGGAGG + Intronic
1078624416 11:12940867-12940889 CTTTAGAGATGGAGGATGGAAGG + Intronic
1078745970 11:14114603-14114625 GTGAAGAAATAGAGGCTGGATGG - Intronic
1078907880 11:15704372-15704394 CTGGAAAACTGGAGGGTGGGAGG - Intergenic
1080890287 11:36403151-36403173 CTGAGGAAATGGAGGATGGATGG + Intronic
1082120893 11:48378602-48378624 CTTTAGCACTGCAGGCTGTATGG - Intergenic
1082837590 11:57663003-57663025 CTGTACAAGATGAGGCTGGAGGG + Intergenic
1084256588 11:67947035-67947057 GTGCAGATCTGGAGGGTGGAAGG - Intergenic
1084953014 11:72677054-72677076 CTGGGGAACTGGAGGTGGGATGG + Intergenic
1085473253 11:76771538-76771560 GTGGAGAGGTGGAGGCTGGAAGG + Intergenic
1086747945 11:90453727-90453749 GTGAAGCACTGGGGGCTGGATGG + Intergenic
1086774684 11:90815476-90815498 CTATAGTTCTGGAGGCTTGATGG + Intergenic
1088775780 11:113081296-113081318 CTGGCTAACTGGAGGATGGAAGG - Intronic
1088811485 11:113395564-113395586 CTCTAGAAATAGAGGCAGGAAGG - Intronic
1088840833 11:113626411-113626433 CTCTAGTTCTGGAGGCTAGAAGG + Intergenic
1089080407 11:115771927-115771949 CTGTAAAACTTCAGGCTAGAAGG + Intergenic
1090585738 11:128210573-128210595 CTGTTGAACTGGGTGCTGAATGG + Intergenic
1090644830 11:128758873-128758895 TTGTAGAAATGGAGACAGGAGGG + Intronic
1090941171 11:131389492-131389514 CTCTAGACCTGCAGACTGGATGG + Intronic
1091216365 11:133904802-133904824 TTGGAGAACTGGAGGGTGGAGGG - Intergenic
1091237974 11:134034299-134034321 CTGCAGAGCTGGAGGAGGGAGGG + Intergenic
1202810832 11_KI270721v1_random:26605-26627 CTGTGGAGCAGGACGCTGGAGGG - Intergenic
1091721926 12:2820199-2820221 CTCAAGAAATGGATGCTGGAGGG + Exonic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1093957014 12:25232003-25232025 CTGTAGGACTAGAGGCTGGGGGG - Intronic
1095158571 12:38888740-38888762 TTGTAGAACTGTAGGTAGGATGG - Intronic
1095964383 12:47857235-47857257 CACACGAACTGGAGGCTGGAAGG + Exonic
1096186039 12:49581157-49581179 ATGTAGAACTGGAGCATGGGAGG + Intronic
1096198934 12:49667188-49667210 CTGAAGAGCTGGTGGGTGGAGGG + Intronic
1096607124 12:52774896-52774918 CTGCAGAACAGGAGATTGGACGG + Intronic
1097636976 12:62134503-62134525 TTGCAGCTCTGGAGGCTGGAAGG - Intronic
1098316948 12:69202787-69202809 CTATGGAACAGGAGACTGGAGGG + Intergenic
1098522362 12:71447787-71447809 CTGTGGAACTGGCTGCTTGAAGG + Intronic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101661092 12:106766264-106766286 GTTTAGAACTTGAGGGTGGAAGG - Intronic
1102617859 12:114170288-114170310 CTGTAGAACTTGATGCTGCTGGG - Intergenic
1103040542 12:117691617-117691639 ATGGAGAACTGGAGGCAGGAGGG - Intronic
1103392328 12:120583656-120583678 CTGTTGAAATGAAGGCTGGGAGG - Intergenic
1105515774 13:21089635-21089657 TTGTAGAAGTGGAGGGTAGAGGG + Intergenic
1108624152 13:52211070-52211092 CAGGAGAACTGAAGGCTGGCAGG + Intergenic
1109307935 13:60661557-60661579 CTGAAGCCCAGGAGGCTGGATGG - Intergenic
1112041351 13:95551951-95551973 CTCTAGACCTGGAAGCTGGAAGG + Intronic
1113271859 13:108683341-108683363 CTATAGAACAGGAGGAAGGAAGG - Intronic
1113610681 13:111642777-111642799 CTGTAAAAGTGGAGGCAGAAAGG - Intronic
1113881436 13:113628908-113628930 CTGTTGAATGGGAGACTGGAAGG + Intronic
1114811124 14:25900854-25900876 CAATTGAAGTGGAGGCTGGAGGG - Intergenic
1115317002 14:32035433-32035455 GTACAGAACTGGAGGGTGGAGGG + Intergenic
1115529923 14:34317588-34317610 CTGAGGAACTGAAGGCAGGAAGG + Intronic
1116417061 14:44691196-44691218 ATGAAGTACTGGGGGCTGGAGGG + Intergenic
1116597410 14:46868407-46868429 CTGCTGAACTGTAGGCTTGATGG - Intronic
1116633959 14:47369535-47369557 CTGGAGGACTGCAGGGTGGAGGG - Intronic
1117119678 14:52553538-52553560 GTGGAGAACTGGAGACAGGAGGG - Exonic
1117287171 14:54297438-54297460 ATGTAGAAATTGAGGGTGGAGGG - Intergenic
1117671948 14:58117057-58117079 CTGGAGAAGTGGAGGCAGGAGGG - Intronic
1119483728 14:74975222-74975244 CTGAAGAGATAGAGGCTGGAGGG + Intergenic
1121739729 14:96242994-96243016 CTGGAGAACTAGAACCTGGAGGG + Exonic
1124588840 15:31035835-31035857 CAGAAGACCTGGAGGCAGGACGG + Intronic
1125783422 15:42292136-42292158 CTGTGAAATTGGAGGCTGGTGGG + Intronic
1125931104 15:43600683-43600705 CTGTAGAACAGTAGGAAGGAAGG + Intronic
1126184851 15:45821850-45821872 CTTTAGGACTGCAGGCTGCATGG - Intergenic
1127621474 15:60738772-60738794 TTACAGATCTGGAGGCTGGAAGG + Intronic
1127854746 15:62945220-62945242 CTGAAGGGCAGGAGGCTGGAAGG + Intergenic
1128254224 15:66185251-66185273 CTGCAGAACTTGAGGCAGCAGGG - Intronic
1128801116 15:70497784-70497806 CTGCAGAATTGGAATCTGGAGGG - Intergenic
1129117917 15:73375554-73375576 TTGTAGAAGTGGAGGCAGGGAGG + Intergenic
1129150811 15:73686739-73686761 TTGTAGAACAAGTGGCTGGATGG + Intronic
1130088724 15:80801305-80801327 CAGAACAACTGGAGGCTGGCTGG + Intronic
1130109730 15:80954372-80954394 CTTCAGTACTGGAGGCAGGAGGG - Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131452887 15:92560888-92560910 CTGTGGACCTGGAGGCAGGCAGG + Intergenic
1132057160 15:98661046-98661068 CTTGAGATCTGAAGGCTGGAAGG - Intronic
1132484466 16:183278-183300 CTGGAGATGTGGAGGTTGGAGGG + Intergenic
1132877272 16:2145623-2145645 CTGTAGGCCTGGAGGCAGGGAGG - Intronic
1133229663 16:4360541-4360563 CTGAAGATCTGGGGGCAGGAAGG + Exonic
1134047829 16:11114344-11114366 CTGTAGAATTGGAGATTCGATGG + Intronic
1136927486 16:34388523-34388545 CTGAGGAACTGCAGGCTGAAAGG + Intergenic
1136977088 16:35023283-35023305 CTGAGGAACTGCAGGCTGAAAGG - Exonic
1138293438 16:55867471-55867493 CTGGAGAACTGGAAAATGGAGGG - Intronic
1139097066 16:63716955-63716977 AGTTAGAACTGGAGACTGGATGG + Intergenic
1139712985 16:68790626-68790648 CTGCAGAGGCGGAGGCTGGAGGG - Intronic
1140048539 16:71459066-71459088 CTGTAGAACTGGACTGAGGATGG - Intronic
1140260191 16:73371475-73371497 CTGTAAAATTGGAGGTTGGCAGG - Intergenic
1140932430 16:79640228-79640250 CTTAAGAACCGGAGGCTGGCCGG + Intergenic
1141873741 16:86807166-86807188 CTGTTGACAAGGAGGCTGGAAGG + Intergenic
1142186564 16:88697626-88697648 CTGTAGTCCTGGAGACAGGAAGG + Exonic
1142356376 16:89603825-89603847 GGGGAGCACTGGAGGCTGGAGGG + Intergenic
1142356469 16:89604086-89604108 GGGGAGCACTGGAGGCTGGAGGG + Intergenic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143504590 17:7356645-7356667 CCTTAGAGCTGGAGGCTGGGAGG - Exonic
1144157310 17:12518412-12518434 GTGTAGCTCTGGAGGCTGGATGG - Intergenic
1146921395 17:36715007-36715029 CTGTAGTGCTGGAGGCTGGGTGG - Intergenic
1147001929 17:37369737-37369759 CTCTGTAACTGCAGGCTGGAGGG + Intronic
1147403227 17:40193246-40193268 CTCCAGAATTGGAGACTGGAGGG + Intronic
1147865211 17:43547274-43547296 CTGATGATCTGGAGGCAGGATGG + Intronic
1148201770 17:45754050-45754072 CTGCAGAGCTGGAAGCTGCAGGG - Intergenic
1149644731 17:58232077-58232099 TTTTAGAACTTGGGGCTGGAGGG + Intronic
1149974865 17:61255363-61255385 CTGGAGATCTGGAGGCTGTAAGG - Intronic
1150015700 17:61554483-61554505 CTGTAGTACTGGTGTCAGGATGG + Intergenic
1150207876 17:63422466-63422488 CTGCAGACCTGGTGGCTGCAGGG - Exonic
1152704639 17:81836641-81836663 CTGCAGCACTTGAAGCTGGATGG + Intergenic
1152795460 17:82304162-82304184 CTGGAGACCGGGAGGCTCGAGGG + Intergenic
1152988026 18:337222-337244 CTGGAGCAATGGAGGATGGATGG + Intronic
1153954096 18:10081348-10081370 CTCTGGCACAGGAGGCTGGAGGG + Intergenic
1156342196 18:36219839-36219861 GTGTGGACCTGGAGGCTGAATGG + Intronic
1158818605 18:61132359-61132381 CAGTAGAGCTGGAAGCTAGATGG - Intergenic
1159014198 18:63088408-63088430 CTGGGTAACAGGAGGCTGGAGGG - Intergenic
1159838425 18:73369262-73369284 CTTTACAACTGCAGGCTGCATGG + Intergenic
1160416121 18:78712216-78712238 CTGGAAAGCTGGAGGCTGGAAGG - Intergenic
1160532435 18:79573425-79573447 ATCTAGAAGAGGAGGCTGGAAGG + Intergenic
1161000327 19:1907611-1907633 CTGGTGAACAGGAGGCTGGGAGG - Intronic
1161012562 19:1967697-1967719 CTGCAGAACTGAAGGGTGGTGGG - Intronic
1161012584 19:1967758-1967780 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1161012605 19:1967819-1967841 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1161012626 19:1967880-1967902 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1161012647 19:1967941-1967963 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1161012666 19:1967995-1968017 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1161012685 19:1968049-1968071 CTGCAGAACTGAAGGGTGGTGGG - Intronic
1161012708 19:1968110-1968132 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1161012762 19:1968272-1968294 CTGCAGAACTGAAGGGTGGTCGG - Intronic
1162508913 19:11105354-11105376 CTGTTGCACTGGAAGCTGGCGGG - Exonic
1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG + Intronic
1164808913 19:31140768-31140790 CTCTGGGACTGGAGGCTGCAGGG - Intergenic
1165106052 19:33470213-33470235 CTGGAGGCCTAGAGGCTGGAGGG - Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166645976 19:44532040-44532062 ATGCAGTTCTGGAGGCTGGAAGG - Intergenic
1166942125 19:46373588-46373610 CTGGAGAACAGGAGACTGGCGGG + Intronic
1167633214 19:50638696-50638718 CGGTCGAACGGGAGGATGGATGG + Intronic
925551977 2:5086374-5086396 CTCCAGAACTGGAGGCAGCATGG + Intergenic
926081802 2:9993223-9993245 CTGAAGAATTGGAGGGTGAAGGG + Exonic
927176845 2:20415822-20415844 CTTTAGGACTGCAGGCTGCATGG - Intergenic
928783100 2:34848701-34848723 CTTTAGTACTGCAGGCTGCATGG - Intergenic
929288201 2:40159982-40160004 CTGTAGAAGATGAGCCTGGAGGG + Intronic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
934909155 2:98234792-98234814 CTGTGGAAAGGGAGGCTGGTTGG - Intronic
935839255 2:107091234-107091256 TTGTAGCATTTGAGGCTGGATGG + Intergenic
935899823 2:107779541-107779563 CTGGAGAACTGGAGGCCGGGTGG + Intergenic
937915575 2:127097257-127097279 CTGGAGAGCTGGCGGCTGGGAGG - Intronic
938946293 2:136215012-136215034 CTGGAAAATTGGAGCCTGGAGGG + Intergenic
939979465 2:148761336-148761358 CTCTGTAACTGGGGGCTGGATGG - Intronic
940106845 2:150110404-150110426 CAATAGAACTGGAAGCTGGCTGG + Intergenic
940378140 2:152981013-152981035 TTGTTGAACTGGAGGATGCATGG + Intergenic
942526894 2:176862260-176862282 CTGGAGGACTGGAGACTGGTTGG + Intergenic
942634405 2:177987129-177987151 CTATAGCACTGCAGGCTGGTGGG - Intronic
943784476 2:191861913-191861935 GTGTAGACCAGGAGGCAGGAGGG - Intergenic
945377324 2:209094300-209094322 CTTTAGAACTGCAGGCTGCATGG - Intergenic
946074925 2:217065836-217065858 CTGGAGAAGAGGAGGCTGGGAGG - Intergenic
946165760 2:217862944-217862966 CTGTAGGTCTGCTGGCTGGAAGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
948576500 2:238955084-238955106 CTGGATAACCGCAGGCTGGAAGG + Intergenic
948579210 2:238972485-238972507 TTGCAGAGCTGGATGCTGGAAGG - Intergenic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1169783603 20:9334801-9334823 CTGTAGAGCTAGGGGCTAGAAGG + Intronic
1170741021 20:19056730-19056752 CTTTAGAACTGCCGGCTGCATGG + Intergenic
1170825461 20:19790801-19790823 GTGAAGTGCTGGAGGCTGGAAGG - Intergenic
1171037403 20:21726817-21726839 ATGCAGAACTTGAGGCTTGAAGG - Intergenic
1172754962 20:37277063-37277085 CTGAAGAACTTGAGATTGGAGGG + Intergenic
1172829729 20:37823428-37823450 CTGAAGCCCTGGAGCCTGGAGGG + Intronic
1172940428 20:38650170-38650192 CTGGAGGGCTGGAGGGTGGAGGG - Exonic
1175101216 20:56580112-56580134 CTGTAGAAATGGAGGAGGGAAGG + Intergenic
1176298158 21:5085365-5085387 TCGCAGAGCTGGAGGCTGGAAGG - Intergenic
1179138080 21:38698279-38698301 TTGTAAAACTAGAGGCTGGATGG + Intergenic
1179858871 21:44176584-44176606 TCGCAGAGCTGGAGGCTGGAAGG + Intergenic
1179897991 21:44373892-44373914 ATGTGGTACTGGAGACTGGAGGG - Intronic
1180616779 22:17133606-17133628 CTGCAGAACTGGAGGTCAGAAGG + Intergenic
1180937303 22:19634194-19634216 TTGCAGTCCTGGAGGCTGGAAGG - Intergenic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181669668 22:24420284-24420306 CTGAGGATCTGGAGCCTGGATGG + Intronic
1182240308 22:28910919-28910941 GTGTAGACCTGGAGGCTGCCTGG + Intronic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184347213 22:43921352-43921374 CTGTCCCACTGGAGGCTGGATGG + Intergenic
1184607252 22:45581272-45581294 GTGGTGATCTGGAGGCTGGAGGG - Intronic
1184631829 22:45787478-45787500 CTTGGGAACTGGAGGCTAGAAGG - Intronic
1185197714 22:49482819-49482841 CAGAAGAACTGGAGACGGGAAGG + Intronic
949357810 3:3200391-3200413 CTGCAAAACTGGGGGCTGGGGGG + Intergenic
949792771 3:7811500-7811522 CAGTAAACCTGGAGGCTGTAAGG + Intergenic
950609282 3:14115044-14115066 CTGCAGAGCTGGATGCTGGAAGG + Intronic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
950950820 3:16996384-16996406 GTGTCCAGCTGGAGGCTGGAAGG - Intronic
951750106 3:26025484-26025506 CTTTAGGACTGCAGGCTGCATGG - Intergenic
954155413 3:48682488-48682510 CTGCAACACTGGAGGCTGAAGGG + Exonic
956601432 3:71026823-71026845 CTGTAGTACTGGAGGCTGGTTGG + Intronic
959441181 3:106377142-106377164 CTATAGAAATGCAGGCTGTAAGG + Intergenic
960085911 3:113591188-113591210 CTGTACTTCTGGAGGCTGCAGGG - Intronic
962055855 3:131870877-131870899 CTGAAGAAGAGAAGGCTGGAAGG + Intronic
963968238 3:151398370-151398392 GTGTATCACTGAAGGCTGGATGG - Intronic
964171813 3:153779660-153779682 TTGTGGAACTGGGTGCTGGAGGG - Intergenic
965269626 3:166597483-166597505 AAGTAGAACTGGAGGCTACAAGG - Intergenic
966855832 3:184193357-184193379 ATGTAGAAGTTGGGGCTGGAAGG - Exonic
967390040 3:188946782-188946804 CTGTAGAAATGGAGTCTTGGAGG - Intergenic
969078316 4:4598585-4598607 CTGTAGCCCTGGAGGCCTGAAGG + Intergenic
969209019 4:5672128-5672150 CTGGAGAACTGGGGGAGGGAGGG + Intronic
969427234 4:7132262-7132284 CCCTGGAGCTGGAGGCTGGACGG - Intergenic
969913021 4:10462238-10462260 CTGTAGGGCCGGAGGCTGCAAGG - Intergenic
970381233 4:15509934-15509956 CTGTAGAACTGCATGCATGACGG - Intronic
972142024 4:35972824-35972846 CTGTAGGATTGGAGGTAGGAGGG - Intronic
973550632 4:52032138-52032160 CTGTCTAACTGCTGGCTGGAAGG + Intronic
974372983 4:61041836-61041858 CTGTGGAAGTGGGGGCTGGTAGG - Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
975765912 4:77667401-77667423 CTGCAGGAGTGGAGACTGGAAGG - Intergenic
979660642 4:123250422-123250444 TCCTAGAACTGGGGGCTGGAAGG + Intronic
980861080 4:138500196-138500218 CTTTAGAATTGCAGGCTGTATGG - Intergenic
980978069 4:139629966-139629988 ATGGAGAGCTGGATGCTGGAAGG + Intergenic
981344077 4:143655008-143655030 GTGTGGAAATGGAGGATGGAGGG - Intronic
982577438 4:157132518-157132540 CTGTAGAACTTAAAGCTGGTGGG - Intronic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
986180221 5:5386082-5386104 CTCTAGAACGGGAGGCAGGCAGG + Intergenic
987692284 5:21282687-21282709 CCGTGGAACAGGAGACTGGAGGG - Intergenic
988790419 5:34602625-34602647 ATGTGGAACTGCAGGCTGGGCGG + Intergenic
991748076 5:69767364-69767386 CCGTTGAACAGGAGACTGGAGGG + Intergenic
991799655 5:70347211-70347233 CCGTTGAACAGGAGACTGGAGGG + Intergenic
991828942 5:70662827-70662849 CCGTTGAACAGGAGACTGGAGGG - Intergenic
991892014 5:71346640-71346662 CCGTTGAACAGGAGACTGGAGGG + Intergenic
994926250 5:106120721-106120743 CTGTGAACCTGGAGGCAGGAGGG - Intergenic
995044640 5:107632014-107632036 CTGGGCAACTGGTGGCTGGAAGG - Intronic
995077098 5:107998767-107998789 CTTTAGCAATGGAGGATGGATGG - Intronic
998678686 5:144439492-144439514 GTGTAAAGCTCGAGGCTGGAAGG - Intronic
999313707 5:150570364-150570386 TTAGAGAACTGGAGGGTGGAGGG - Intergenic
999359585 5:150971883-150971905 CTCTAGGAGTGGAGGCTGGGAGG - Intergenic
1000364220 5:160476283-160476305 CCGAAGAACTGGAGGTTTGAGGG + Intergenic
1000784315 5:165525006-165525028 CAGTAGAAAGGGAGGCTGAAAGG + Intergenic
1001257467 5:170195102-170195124 CTGTGGAATTGGAGCCGGGAGGG - Intergenic
1002854817 6:1027332-1027354 CTGGGGAACTGGGGGCAGGAAGG + Intergenic
1003958863 6:11190990-11191012 CTGCAGAACCGGTGGCTCGAAGG - Exonic
1004075445 6:12340319-12340341 CTGTGGAGCTGAATGCTGGAGGG + Intergenic
1005244094 6:23861983-23862005 CTCTAGGACTGCAGGCTGGGTGG + Intergenic
1006096474 6:31659618-31659640 CTGGGAGACTGGAGGCTGGAGGG - Exonic
1007769338 6:44180511-44180533 CTGTAGGGCTGGGGGTTGGAAGG + Intronic
1007986355 6:46211071-46211093 CTGAAGAAGTGGAGCATGGAAGG - Intergenic
1015718359 6:136214931-136214953 CTGGAGAACTGGGGGTGGGAAGG + Intergenic
1015791359 6:136967569-136967591 CTGGAGATCTCCAGGCTGGATGG - Intergenic
1016599200 6:145837815-145837837 ATGTAGAACTGGTGCCTGAAGGG - Intergenic
1017679212 6:156846675-156846697 CTGGAGAGCTGGAGGCTGACTGG + Intronic
1018030314 6:159836607-159836629 CTGTAGAAAAGAAGCCTGGAGGG + Intergenic
1018698857 6:166411752-166411774 CAGTCCAGCTGGAGGCTGGAGGG - Exonic
1019033997 6:169039493-169039515 CTGGAGACTTGGAGGGTGGAAGG + Intergenic
1021742857 7:23705170-23705192 CTTTAGATCTGGAAACTGGATGG - Intergenic
1022461155 7:30608525-30608547 CTGTAGAAATAGAGTCTAGAAGG + Intronic
1024100818 7:46030929-46030951 TTGAGAAACTGGAGGCTGGAGGG + Intergenic
1024367328 7:48535821-48535843 CTTTAGGACTGCAGGCTGTATGG - Intronic
1025709407 7:63893063-63893085 CTGAGGTCCTGGAGGCTGGAGGG + Intergenic
1026191780 7:68135503-68135525 ATGTAGAATTGAAGGATGGAAGG + Intergenic
1026606469 7:71820284-71820306 CTGGACAACTGGAGGTTGGTGGG - Intronic
1028290229 7:89056531-89056553 ATCTAGGACTGGAGGCAGGAGGG - Intronic
1030065261 7:105654500-105654522 CTGTAGCACTGGAAGCCAGAAGG + Intronic
1033375363 7:140756359-140756381 CTGTAGAATGAAAGGCTGGAAGG + Intronic
1033636003 7:143211700-143211722 TTGTAGAACTGGAGTAGGGAAGG + Intergenic
1033899402 7:146116711-146116733 CGGAAGAACTGGAGCCTGGAGGG + Exonic
1034229967 7:149516232-149516254 CTTTAGGACTGCAGGCTGCATGG - Intergenic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034326979 7:150245466-150245488 CTGGAGAACAGAAGGCCGGAGGG + Intronic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1034766229 7:153723985-153724007 CTGGAGAACAGAAGGCTGGAGGG - Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1038704080 8:29877841-29877863 AAGTGAAACTGGAGGCTGGAAGG + Intergenic
1038908728 8:31937695-31937717 CTTTAGGACTGCAGGCTGCATGG + Intronic
1039101734 8:33948710-33948732 CTGTTGGAGTGGTGGCTGGAAGG + Intergenic
1039327628 8:36502690-36502712 AACTAGAACTGGAGGATGGAGGG - Intergenic
1039376317 8:37037765-37037787 ATGAAGAAATGGAGGCTGAAAGG + Intergenic
1039424988 8:37478196-37478218 TTGAAGGACAGGAGGCTGGAGGG - Intergenic
1041419220 8:57647733-57647755 CTGGAGAAATGGAAGATGGATGG - Intergenic
1041419282 8:57648359-57648381 CTCTAGAAATGGAGGGTGGGTGG - Intergenic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1042756802 8:72223159-72223181 CTGCAGAACTTGAGGGTAGATGG + Intergenic
1044027008 8:87184709-87184731 ATGTAGACCCGGAGGCTGAAAGG - Intronic
1045769668 8:105721131-105721153 CTGCAGAACTGGAGTATGCATGG - Intronic
1048973399 8:139657625-139657647 CTGCAGAAGTGGGGGATGGATGG + Intronic
1049105875 8:140612412-140612434 CTGTAGAACTGCAGCCCGAATGG - Intronic
1049192624 8:141296974-141296996 CTCAAGTTCTGGAGGCTGGAAGG - Intronic
1049403965 8:142443401-142443423 CTGCAGCACTGGAGGCAGGTGGG + Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1050980598 9:12008863-12008885 CTGTAGAACTGCAAGGTGGAAGG + Intergenic
1055887950 9:81086920-81086942 CTGAAGAATTGGAGGTTGGGGGG + Intergenic
1057081751 9:92178779-92178801 TTGGAGAACTGTATGCTGGAGGG + Intergenic
1058138026 9:101328838-101328860 GTGAAGAACTGAAGGCTGGCTGG + Intergenic
1060863442 9:126975382-126975404 CCCTAGAACTGGTGGCAGGATGG + Intronic
1061788022 9:133042473-133042495 CTGGGGAACTGTTGGCTGGAGGG - Intronic
1062365691 9:136207969-136207991 CTGTGGACCTGGGGGTTGGAAGG - Exonic
1062480237 9:136747712-136747734 CTGGAAGGCTGGAGGCTGGAGGG - Intronic
1062480289 9:136747893-136747915 CTGGAAGGCTGGAGGCTGGAGGG - Intronic
1062480314 9:136747998-136748020 CTGCAGAACTGGAGGCTGGAGGG - Intronic
1062480319 9:136748021-136748043 CTGGAGGGCTGGAGGCTGGAGGG - Intronic
1062480324 9:136748036-136748058 CTGTAGAACTGGAGGCTGGAGGG - Intronic
1062480329 9:136748059-136748081 CTGCTGGGCTGGAGGCTGGAGGG - Intronic
1062480341 9:136748104-136748126 CTGGAGGGCTGGAGGCTGTAGGG - Intronic
1062480345 9:136748119-136748141 TTGGAGAACTGGAGGCTGGAGGG - Intronic
1062480364 9:136748194-136748216 CTGGAGGGTTGGAGGCTGGAGGG - Intronic
1186569257 X:10697025-10697047 CTATTGAAGTGGAGGCAGGAGGG - Intronic
1187098610 X:16170213-16170235 CTGGAGAACAGGAGCCTGGTGGG + Intronic
1187265100 X:17725255-17725277 CTGTAGATCTGTGGGCTGGCAGG - Intronic
1187542779 X:20214466-20214488 CAGCAGAACTGGATGCTAGAAGG - Intronic
1187733184 X:22277572-22277594 CTGTAAAACGTGAGGCAGGAAGG - Intergenic
1189230102 X:39445428-39445450 ATCGAGAACTGGAGGCTGGGTGG - Intergenic
1192179947 X:68910160-68910182 CTGGAGAACTGGAGGCCCCATGG - Intergenic
1192588821 X:72342579-72342601 TTTTAGAACTAGAAGCTGGAGGG + Intronic
1192609619 X:72554561-72554583 CTCTAGGACTGCAGGCTGCATGG + Intronic
1193799031 X:85913426-85913448 CTGGAGGACAGGAGGCAGGAAGG + Intronic
1194523128 X:94942894-94942916 CTGGAGCCATGGAGGCTGGATGG + Intergenic
1195349793 X:103985311-103985333 TTGTAGTGCTGGATGCTGGAAGG - Intergenic
1195352139 X:104005831-104005853 TTGTAGTGCTGGATGCTGGAAGG + Intergenic
1195357098 X:104049070-104049092 TTGTAGTGCTGGATGCTGGAAGG - Intergenic
1195357650 X:104053528-104053550 TTGTAGTGCTGGATGCTGGAAGG + Intergenic
1196757125 X:119167677-119167699 CTGTCTAACTGGAGTCAGGAAGG + Intergenic
1197545166 X:127815627-127815649 CTTTAGAACTGCAGGCTGCATGG + Intergenic
1198117307 X:133556600-133556622 ATGTAGGAATGGAGGCTGTATGG + Intronic
1198231439 X:134693231-134693253 CTGGAGAGCTGGAGGCAGGAAGG - Intronic
1198664710 X:139007979-139008001 CTTTAGGACTGCAGGCTGCAAGG + Intronic
1199487388 X:148362841-148362863 CTGTAGATGTGGTGGGTGGAGGG + Intergenic
1200332654 X:155313866-155313888 CTTTAGGACTGCAGGCTGCATGG + Intronic
1202092523 Y:21208840-21208862 CTGGAGCAAGGGAGGCTGGAGGG + Intergenic
1202270176 Y:23063980-23064002 CTGTAAAACTGAATGCTAGATGG + Intergenic
1202295851 Y:23356702-23356724 CTGTAAAACTGAATGCTAGATGG - Intergenic
1202423170 Y:24697725-24697747 CTGTAAAACTGAATGCTAGATGG + Intergenic
1202447619 Y:24972361-24972383 CTGTAAAACTGAATGCTAGATGG - Intergenic