ID: 1062480482

View in Genome Browser
Species Human (GRCh38)
Location 9:136748605-136748627
Sequence GCCTCCTGCAAAATTACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062480477_1062480482 -8 Left 1062480477 9:136748590-136748612 CCAGGAACCCTCCTGGCCTCCTG 0: 1
1: 0
2: 5
3: 48
4: 501
Right 1062480482 9:136748605-136748627 GCCTCCTGCAAAATTACCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 119
1062480474_1062480482 13 Left 1062480474 9:136748569-136748591 CCGTGTGGGTGGCACTAACTGCC 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1062480482 9:136748605-136748627 GCCTCCTGCAAAATTACCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062480482 Original CRISPR GCCTCCTGCAAAATTACCCA GGG Intergenic
905755989 1:40509291-40509313 GCCTTCTGCAGAATTGCCGATGG - Exonic
909505704 1:76387291-76387313 TCTTCCTGCAAAATTCCTCAGGG + Intronic
909521173 1:76569445-76569467 TCCTACTGCAAAATTGGCCAAGG + Intronic
909717558 1:78728010-78728032 GCCTTATCCAAAATCACCCATGG + Intergenic
920172065 1:204078349-204078371 GCTTCCTGGAGACTTACCCAGGG - Intronic
923331761 1:232931760-232931782 GCCTCCTTCAAAAGAACCTAGGG + Intergenic
1065979489 10:30878229-30878251 GCCTTTTCCAAAACTACCCATGG + Intronic
1067338690 10:45383930-45383952 CCCTCCTGCACATCTACCCAAGG + Intronic
1068036645 10:51767858-51767880 CCCTCCAGGAAAATTAGCCATGG + Intronic
1068511586 10:57972643-57972665 TCTTCTTCCAAAATTACCCATGG - Intergenic
1069882914 10:71604731-71604753 GCCTCCTGCAGAATCTTCCAGGG + Intronic
1070240349 10:74674044-74674066 GCCTTTTCCAAAATCACCCATGG - Intronic
1073430465 10:103483286-103483308 TCCTTCTGCAAAGCTACCCATGG - Intergenic
1078330344 11:10414170-10414192 ACCACGTGGAAAATTACCCAAGG - Intronic
1079419161 11:20270069-20270091 GCCTCCTCCTAACTTCCCCATGG + Intergenic
1085138197 11:74113782-74113804 GCCTCCAGTAAAATTACAGATGG - Exonic
1088513717 11:110604658-110604680 TCCCCTTTCAAAATTACCCAAGG + Intronic
1089302707 11:117508174-117508196 GCCTCCTGGAAAACTCCCCTGGG + Intronic
1093480178 12:19596210-19596232 GCAGTCTGCAAAATTATCCAAGG - Intronic
1093916720 12:24810825-24810847 GCCAAGTGCAGAATTACCCAAGG - Intergenic
1098397627 12:70038369-70038391 GCCTCCTGCAAAATGATGCATGG - Intergenic
1102708993 12:114908815-114908837 GCCTTCTGCCAAATGACCCCAGG - Intergenic
1104285109 12:127418031-127418053 GCCTTTTCCAAAACTACCCATGG + Intergenic
1104554914 12:129790640-129790662 GCCTTTTCCAAAACTACCCATGG - Intronic
1110543930 13:76735933-76735955 ACCTTTTGCAAAATTACTCAAGG + Intergenic
1111726282 13:92013492-92013514 GCCTTTTGCAAAACTACCAATGG - Intronic
1116469406 14:45269662-45269684 GCATCCTGCAAAATTGCCAGAGG + Intergenic
1116705465 14:48292246-48292268 TATTCCTGCAAAATTTCCCAAGG + Intergenic
1117303313 14:54449343-54449365 CCTTCCTGCAAAAATTCCCAAGG + Intergenic
1117574154 14:57081391-57081413 ACTTCCTGGAAAATTATCCATGG - Intergenic
1119882206 14:78109166-78109188 GCATACTTCAAAATAACCCATGG - Intergenic
1122424192 14:101596227-101596249 CCCTCCTGCAAGATTCCCCCAGG + Intergenic
1129247322 15:74287395-74287417 GCCTCCTGCCAAATGACCTGAGG - Intronic
1129542927 15:76365739-76365761 GCCTCCTGATATATTATCCAGGG - Intronic
1130081001 15:80733358-80733380 GCCTCCTTGAGAATTACACAAGG - Intronic
1130621150 15:85463822-85463844 GCCACCAGCAACATCACCCAGGG - Intronic
1130781047 15:87041719-87041741 GCCTCCTGTCAAATCAGCCAGGG + Intergenic
1132001926 15:98189215-98189237 TTCTCCTCCAAGATTACCCAAGG + Intergenic
1136556675 16:31011056-31011078 GCCTCCTGCAAGAACACACATGG - Intergenic
1138914097 16:61441736-61441758 GTTTCCTGCAAAATTAAGCATGG + Intergenic
1139890948 16:70253005-70253027 GCCTCCAGCAGTATCACCCAGGG - Intronic
1142275500 16:89116642-89116664 GCCTGCTGCAACAGTGCCCAGGG + Intronic
1144022723 17:11251456-11251478 GACTCATGCAGAATTGCCCAGGG - Intronic
1151940211 17:77287346-77287368 GCCTCCTGGCAAATTTCCCGGGG - Intronic
1153458157 18:5301649-5301671 TCCTGCTGCAAAATTACTCATGG + Intergenic
1157089764 18:44623877-44623899 ACCTCCTTCAAAATTATCCCAGG + Intergenic
1158653275 18:59306823-59306845 GCCTCATTCACAATTCCCCAGGG - Intronic
1159684125 18:71395132-71395154 GCCTCCTGCATCATTTCCAAGGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
1164930512 19:32172197-32172219 GACTCCAGATAAATTACCCAGGG + Intergenic
926851107 2:17198294-17198316 GCTTCCTTGAAAATTACCCAAGG + Intergenic
927209986 2:20633262-20633284 GCCTTCTGCAAAGCTGCCCAGGG + Intronic
928419968 2:31130706-31130728 AGCTCCTGCAGAATTCCCCAGGG + Intronic
929863154 2:45696414-45696436 GCCTCCTGCCAAATGCCCCAGGG - Intronic
931419451 2:62112831-62112853 GCCTTCTCCATCATTACCCATGG - Intronic
934855729 2:97728431-97728453 GGCTCCTGGAAAATTAGGCAAGG + Intronic
935036651 2:99382930-99382952 GCCTTCTGAAAAATTAACCTAGG + Intronic
941628851 2:167861996-167862018 GGCTCCTGCAACCTTGCCCATGG + Intergenic
942320062 2:174728879-174728901 GCCTCCTGCCTCATTATCCAAGG + Intergenic
942958900 2:181806213-181806235 CCCTCCTGCCAACTTGCCCAAGG + Intergenic
943544352 2:189256365-189256387 GCCACCAGCAGTATTACCCAAGG + Intergenic
944001347 2:194842456-194842478 GCCTTTTCCAAAATCACCCATGG + Intergenic
946471373 2:219964209-219964231 GCCTTTTCCAAAACTACCCATGG + Intergenic
1172264278 20:33597519-33597541 GCCTCCTGCCAGATCAGCCATGG + Intronic
1174421412 20:50401386-50401408 GGCTCCTGCAAAATTTACAAGGG - Intergenic
1176283751 20:64330391-64330413 GCCTGCAGCATAATTATCCATGG + Intergenic
1177243779 21:18495739-18495761 GCCTCCTGCTGAAATACTCAAGG + Intergenic
1180087742 21:45515623-45515645 GCCGCCTGCAAAGTTACCACAGG + Exonic
1183067056 22:35370475-35370497 GCCGCCTCCAAAGTTACCCTTGG - Intergenic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
949905797 3:8857407-8857429 CCCTGCTGCAAAATAACCGAAGG - Intronic
950254518 3:11493388-11493410 GCCTTTTGCAAAACTACCTATGG - Intronic
950656386 3:14439634-14439656 GGCTGCTGCAAAATAACCCTGGG + Intronic
953204454 3:40811631-40811653 GCATACAGCAAAATTACCCTTGG - Intergenic
954160309 3:48716965-48716987 CCCTCCTCCCAAATGACCCAGGG + Intronic
954496821 3:50972297-50972319 GCCTCCTGCAGGAGTAGCCATGG + Intronic
955601581 3:60651362-60651384 GCCACCTGTAAAATTAACAAAGG - Intronic
960191271 3:114709330-114709352 GTCTCTTGCACAATTACCTATGG - Intronic
960342700 3:116494463-116494485 GCTTCCTACAAAGTTACTCAAGG + Intronic
962881712 3:139583978-139584000 GCCTCTAGCAATATTGCCCAAGG - Intronic
964822071 3:160781724-160781746 GCCTTCTGAAAAATTACCACTGG - Intronic
965074481 3:163959306-163959328 GACTCCTGCAATCTTAACCACGG + Intergenic
972388196 4:38587863-38587885 GTCTACTGCCAAATTACACATGG - Intergenic
973828065 4:54729258-54729280 GCCTCCCATAAAAATACCCAAGG - Intronic
976859033 4:89640779-89640801 GCCTTTTCCAAAATCACCCATGG + Intergenic
978432601 4:108649488-108649510 GCATCCTGTAAAAATAACCACGG + Intergenic
978593849 4:110355880-110355902 GCCTTTTCCAAAATCACCCATGG + Intergenic
979823609 4:125205028-125205050 GCTTCCTGCAAAATTATTCGTGG - Intergenic
984300661 4:177912679-177912701 GCCTTTTCCAAAACTACCCATGG - Intronic
987586509 5:19863488-19863510 GCCTCCTGTCAAATTCCCCATGG + Intronic
988028985 5:25738706-25738728 GACTCCTGCAATCTTAGCCATGG + Intergenic
993560915 5:89407231-89407253 GCCTTCTGAAGAATTTCCCAAGG - Intergenic
994407247 5:99360052-99360074 GCCTCTTCCAAAACTACCTACGG - Intergenic
995740893 5:115354662-115354684 GCCTTTTGCAAAATTACCCATGG - Intergenic
997010053 5:129866125-129866147 GACTTCTTCAAAATTACACATGG + Intergenic
1000379877 5:160619563-160619585 GCCTCCTGCATTATCAGCCATGG - Intronic
1001295591 5:170496647-170496669 GACTCCTGGACATTTACCCAAGG + Intronic
1002127743 5:177059398-177059420 ACCTACTGTAAGATTACCCAGGG + Intronic
1002949668 6:1797119-1797141 GCCTCCTGACAGATTAGCCAAGG + Intronic
1003039317 6:2672220-2672242 ACCTACTGCAGAATTAGCCAGGG - Intronic
1007853224 6:44825511-44825533 GTCTTATGCAGAATTACCCAAGG - Intronic
1011735349 6:90304707-90304729 GCCTTCTGCAAAATCACCAAAGG - Intergenic
1012765036 6:103357287-103357309 GACTCCTGCAAATCTACCCATGG + Intergenic
1018399047 6:163404274-163404296 GCCTCCAGAAAACTTACCAATGG - Intergenic
1020458352 7:8399867-8399889 CCCTCATGCAAATTTACCCCTGG + Intergenic
1020924203 7:14303862-14303884 GCCACCATGAAAATTACCCAAGG + Intronic
1026761777 7:73132223-73132245 CCCTCTTGCAAACTGACCCATGG - Intergenic
1027038117 7:74941044-74941066 CCCTCTTGCAAACTGACCCATGG - Intergenic
1027085446 7:75260432-75260454 CCCTCTTGCAAACTGACCCATGG + Intergenic
1028652210 7:93162222-93162244 GCCTTTTCCAAAACTACCCATGG - Intergenic
1033720580 7:144055138-144055160 GCCTCCTGCAAGATTCTCGATGG - Intergenic
1035298413 7:157880526-157880548 CCTCCCTGCAAAATCACCCAAGG + Intronic
1037415765 8:18648596-18648618 GCCTGCTGCAAATTTTCACATGG - Intronic
1037757983 8:21723696-21723718 TCTTGCTGCAAAATTTCCCAGGG - Intronic
1041653247 8:60322149-60322171 TCATCCTGGCAAATTACCCAGGG - Intergenic
1042176833 8:66045711-66045733 CCCTCCTTCAAAATTATCCCAGG - Intronic
1044429558 8:92093083-92093105 GCCTTCTGAAAATTTACACATGG + Intronic
1046587413 8:116164299-116164321 TCCTCCTGCAAAACTTCTCATGG + Intergenic
1048857446 8:138696877-138696899 TCCTCCTAGAAAACTACCCATGG + Intronic
1049746569 8:144265654-144265676 GCTTCCTGCAACAGTAGCCACGG + Intronic
1052122170 9:24731087-24731109 GCCTTTTGCAAAACTACCCATGG - Intergenic
1055139013 9:72854311-72854333 GCCTACTGCAAAAGGAACCATGG + Intergenic
1058647466 9:107143909-107143931 GCCTGCTGCAGAAAGACCCAAGG + Intergenic
1059436158 9:114277705-114277727 CCCTCCTGCTAAATTCCCCTTGG - Intronic
1061509965 9:131054376-131054398 GCCTCCCAAAACATTACCCATGG - Intronic
1062480482 9:136748605-136748627 GCCTCCTGCAAAATTACCCAGGG + Intergenic
1185471614 X:387027-387049 GCCTCCTGCAAAAGCTCCGAGGG - Intergenic
1186127135 X:6426220-6426242 GCCTTCTCCAAAACCACCCATGG - Intergenic
1189776554 X:44475011-44475033 ATCTGCTGCAAAATTACCTAGGG + Intergenic
1194053475 X:89101235-89101257 GCATCCAGCAAAATTACGGAGGG - Intergenic