ID: 1062482952

View in Genome Browser
Species Human (GRCh38)
Location 9:136760840-136760862
Sequence CAGGTGGGCCTGAAGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062482952_1062482958 -7 Left 1062482952 9:136760840-136760862 CCCCAAAACTTCAGGCCCACCTG 0: 1
1: 0
2: 0
3: 22
4: 239
Right 1062482958 9:136760856-136760878 CCACCTGGAACCTCCGAACGTGG No data
1062482952_1062482961 3 Left 1062482952 9:136760840-136760862 CCCCAAAACTTCAGGCCCACCTG 0: 1
1: 0
2: 0
3: 22
4: 239
Right 1062482961 9:136760866-136760888 CCTCCGAACGTGGCCTTATTTGG No data
1062482952_1062482963 9 Left 1062482952 9:136760840-136760862 CCCCAAAACTTCAGGCCCACCTG 0: 1
1: 0
2: 0
3: 22
4: 239
Right 1062482963 9:136760872-136760894 AACGTGGCCTTATTTGGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062482952 Original CRISPR CAGGTGGGCCTGAAGTTTTG GGG (reversed) Intronic
901197244 1:7447107-7447129 CAGGTGGGCATGAGGGGTTGGGG - Intronic
901442485 1:9286995-9287017 CAGGTGGACATGAATTTTGGGGG + Intergenic
902144985 1:14391167-14391189 CAGGGGAGCCTGAAGTGGTGAGG + Intergenic
902761192 1:18581683-18581705 CGGGAGGGCCTGAGGTTTTTGGG - Intergenic
905625925 1:39490935-39490957 CAGCTGGGCCAGAAGCTCTGGGG - Intergenic
906877700 1:49556889-49556911 CGGGTGGGCCTGCAGTGCTGGGG + Intronic
911202600 1:95060841-95060863 CAGGTGGACATGAATTTTAGGGG - Intronic
913326637 1:117633807-117633829 GAAGTGGGTCTGAAGTTCTGGGG - Intergenic
913445417 1:118945422-118945444 CAGGTGGGCTGTAAGTTTTGAGG + Intronic
913965339 1:143372437-143372459 TTGGTGGGCCTGAAGTTCTTTGG - Intergenic
914059715 1:144198039-144198061 TTGGTGGGCCTGAAGTTCTTTGG - Intergenic
914119435 1:144768332-144768354 TTGGTGGGCCTGAAGTTCTTTGG + Intergenic
914918180 1:151830952-151830974 CAGGTGGCCCTGGAGCTTGGTGG + Intronic
915292905 1:154898198-154898220 CAGGTGGGCTGTAAGTTTTGTGG - Intergenic
915366286 1:155318513-155318535 AATATGGGCCTTAAGTTTTGGGG + Intronic
915599177 1:156912049-156912071 CACGTGGGTCTGGAGTTTGGGGG + Intronic
916062984 1:161114387-161114409 CAGGTGGGACTTAATGTTTGAGG - Intronic
916115045 1:161479176-161479198 CAGGTGGGCCGGCAGTGCTGGGG - Intergenic
917435120 1:175013189-175013211 CAGGTGGAGGTGAAGTTATGAGG - Exonic
920799560 1:209173926-209173948 CAGGTGGAGCTGAAGTCATGGGG - Intergenic
1062846312 10:708909-708931 CAGCAGGGCCTGGAGTTTTAAGG + Intergenic
1063497894 10:6527024-6527046 CAGGGCGGCCTCAAGGTTTGGGG + Intronic
1063818994 10:9812798-9812820 CAGGTGCGCGTGTAGCTTTGTGG - Intergenic
1064193648 10:13228318-13228340 CAGGGAGGCCAGGAGTTTTGAGG - Intronic
1064585350 10:16834313-16834335 CTCGTGGGCCTGAAACTTTGGGG - Intronic
1065130202 10:22612843-22612865 CAGGTGGGTCTGAAGTTCCCAGG + Intronic
1065393915 10:25213714-25213736 CATCTAGGCCTGAAGTTTTCAGG + Intronic
1066567391 10:36734807-36734829 CCGGTGGGCCTGCACTGTTGGGG + Intergenic
1066647657 10:37625783-37625805 CAGGTGGTCCTAGATTTTTGAGG - Intergenic
1067213166 10:44278791-44278813 CAGGTTTCCCTGAAGTTTGGTGG + Intergenic
1067323137 10:45241251-45241273 CTTGTGGGCCTGAACCTTTGGGG - Intergenic
1067545676 10:47191096-47191118 CTGCTGGGCCTGGAGGTTTGTGG + Intergenic
1070358688 10:75665317-75665339 CAGGTGGGGCTGAAGCCTGGTGG + Intronic
1070963294 10:80514321-80514343 GAGGTGGGATGGAAGTTTTGAGG + Intronic
1071928153 10:90435288-90435310 CAGATTGTCCTGAAGATTTGGGG - Intergenic
1074936940 10:118191030-118191052 CAGCTGAGCCTGAAGTTATAGGG + Intergenic
1075290745 10:121228579-121228601 CTGGTGGCCCTGCAGTTCTGTGG + Intergenic
1076441996 10:130486356-130486378 CAGGTGGGCACGAACTTTCGGGG + Intergenic
1076695706 10:132246331-132246353 CAGGCAGGCCTGGGGTTTTGGGG + Intronic
1078096291 11:8299292-8299314 CAGGTGGGCCTGAGACTGTGAGG + Intergenic
1078663566 11:13306307-13306329 CAGGAGGTCCTGAAGTCCTGAGG + Intronic
1078904462 11:15671266-15671288 CAGGTGGCCCTGAAGTGTAGTGG - Intergenic
1081374698 11:42344521-42344543 CAGGTGGGCCAGCAGTGCTGGGG + Intergenic
1082912039 11:58388397-58388419 GAGGTGGACCTGTAGTTCTGGGG + Intergenic
1083146537 11:60763936-60763958 CAGGAGAGCCCAAAGTTTTGGGG + Exonic
1083441448 11:62679149-62679171 CAGCAGGGCCAGAAGTTTTATGG - Intergenic
1084170452 11:67398436-67398458 CAGGTGGGCCTGAGGGGTCGGGG + Exonic
1084289394 11:68152133-68152155 CAGGAGGGCCAGGAGGTTTGAGG - Intergenic
1084642611 11:70434736-70434758 CAGGCGGGGCTGGAGTTATGTGG + Intronic
1085693857 11:78687459-78687481 CAGGTGGGCTTGCAGCTTTGTGG - Intronic
1087291923 11:96329384-96329406 AAGGAGGGTCTGAAGTTATGTGG - Intronic
1087901067 11:103641743-103641765 CAGGTGGACATGAATTTTGGGGG - Intergenic
1088763662 11:112956331-112956353 AAGGTGGGGCTGAGGTTTTGTGG + Intergenic
1089180760 11:116581360-116581382 CAGGAGGGCCTCCAGTGTTGGGG + Intergenic
1090528612 11:127564703-127564725 CAGGTGGCTCTGAATTTCTGTGG + Intergenic
1090584253 11:128193112-128193134 TAGGTGGGGCTGGAGTGTTGAGG - Intergenic
1091238001 11:134034420-134034442 CAGGGAGCCCTGAGGTTTTGCGG + Intergenic
1092098950 12:5867273-5867295 CAGGTGGGGCTGTAGTTCTCTGG - Intronic
1092532240 12:9354116-9354138 CAGCTGTCCCTGCAGTTTTGTGG + Intergenic
1092659331 12:10722427-10722449 CACGTGGGCCTGGCGCTTTGGGG - Intronic
1093242703 12:16697552-16697574 CAGGGCTGTCTGAAGTTTTGGGG + Intergenic
1093617256 12:21241389-21241411 CCTGTGGGCCTGAAGTGTTGTGG + Intergenic
1093938461 12:25026508-25026530 CAGGGGGGATTGAAGGTTTGTGG + Intronic
1094272045 12:28627808-28627830 CAGGTGGACCTGTTGCTTTGAGG - Intergenic
1094346185 12:29471871-29471893 CAGGTGGGTCTGAGGTTTCTAGG - Exonic
1095669560 12:44842674-44842696 CCAGTGGGCATGAATTTTTGGGG - Intronic
1097051976 12:56229132-56229154 CAGGCGGGCCTGCAGGTGTGTGG - Exonic
1097350026 12:58538625-58538647 CAGGTAGGCATGAATTTTGGGGG - Intergenic
1100795735 12:98179908-98179930 CAGGTGGACATGAATTTTAGTGG + Intergenic
1100796936 12:98192057-98192079 CAGGGGGGCTTGCAGTTTAGAGG + Intergenic
1101849153 12:108388461-108388483 AAGGTTGGCCTGAAGTGCTGGGG + Intergenic
1103535376 12:121630116-121630138 CAGGTGGCCGGGAAGTGTTGGGG + Intronic
1110383378 13:74879609-74879631 AAAGTGGTCTTGAAGTTTTGTGG - Intergenic
1114498308 14:23149362-23149384 TGGGTGGGCCTGAAGTTGTAAGG - Intronic
1117061004 14:51963955-51963977 CAGGTGGGCATAAATTTTAGGGG - Intronic
1119204005 14:72780571-72780593 GAGGTGAGCCTGAAGTTATCTGG + Intronic
1120731586 14:88008869-88008891 TAGGTTGGCCTGAAGTTTGCAGG + Intronic
1122123569 14:99567345-99567367 CAGGAGGGACAGAAGTTTTTCGG + Intronic
1202857451 14_GL000225v1_random:59768-59790 TGCGTGGGCCTGATGTTTTGCGG - Intergenic
1124394095 15:29285584-29285606 CATCTTGGCCTGAAGTTTTCTGG - Intronic
1125367046 15:38928899-38928921 AATATGGGCCTGAAGTTTTTGGG + Intergenic
1125591214 15:40855745-40855767 CAGCTGGGCCAGGTGTTTTGGGG + Intronic
1129453724 15:75664832-75664854 AAGGTGGGCCTGAGGTTCAGGGG - Intergenic
1130975723 15:88772674-88772696 CAGGTGGGGCTGAGGGTTGGTGG + Intergenic
1131816217 15:96223811-96223833 AAGGGGGGCCTGATGCTTTGGGG + Intergenic
1132847251 16:2006303-2006325 CAGGAGGGCGTGCAGGTTTGGGG + Intronic
1132983301 16:2750346-2750368 TAGGTGGTTGTGAAGTTTTGGGG + Intergenic
1133326644 16:4945966-4945988 CTGGTGGGGCTGCATTTTTGGGG + Intronic
1133495604 16:6314413-6314435 CCAGTGGGCCTGAATTTTAGGGG - Intronic
1136066697 16:27763852-27763874 CAGGTGGACCTGAATTTTACTGG + Intronic
1136454264 16:30371449-30371471 CACCTGGGCCTGGAGTGTTGGGG - Intronic
1136655543 16:31707015-31707037 CAGGTGGGCCTGAGGCTGTGAGG - Intergenic
1137442346 16:48508006-48508028 CAGGTGGGCCTGAAGCTCCCAGG + Intergenic
1138398203 16:56724302-56724324 CACCTGGGCCTGGAGTTTTCTGG + Intronic
1139211473 16:65082108-65082130 TAGGTGGGCAAGCAGTTTTGTGG - Intronic
1140522850 16:75597121-75597143 CAGGTAGACATGAAGTTTTGGGG - Intronic
1141205687 16:81931678-81931700 CAGGTGGGCCTGGCATTCTGAGG + Intronic
1141948606 16:87326356-87326378 CAGGTGGGGCAGCTGTTTTGGGG - Intronic
1141977301 16:87525420-87525442 CAGGTGGACATGCATTTTTGGGG + Intergenic
1142063873 16:88049191-88049213 CCGGTTGGCCAGAAGTTCTGAGG - Intronic
1142642545 17:1292835-1292857 CCAGTGGGCCAGAAGTTCTGTGG + Intronic
1143336382 17:6174648-6174670 CAGGTGAGTCGGAAGATTTGTGG - Intergenic
1143355267 17:6323175-6323197 CGGTTGTGCCTGAAGTTTGGCGG + Intergenic
1144109729 17:12020587-12020609 AAGGTGGGCCTGCATTTGTGCGG - Intergenic
1144956503 17:19021387-19021409 CAGGTGGAGCTGAAGTCATGGGG + Exonic
1145271991 17:21409740-21409762 CAGGTGGGCCTGAGGTGGTAAGG + Intronic
1145310197 17:21697203-21697225 CAGGTGGGCCTGAGGTGGTAAGG + Intronic
1145763994 17:27445403-27445425 CAGGTGGGACTGGAGTGATGTGG - Intergenic
1145842141 17:28004284-28004306 CATGTGAGTCTGAAGTTTGGAGG + Intergenic
1146182521 17:30707289-30707311 CAGATATGCCTCAAGTTTTGTGG + Intergenic
1149985565 17:61344476-61344498 AAGGTGGGTCCTAAGTTTTGAGG + Intronic
1152603847 17:81278968-81278990 CAGGTGGCCAGGAGGTTTTGTGG - Intronic
1153185788 18:2484814-2484836 CAGGTTGGGGTGAAGTTTTTGGG - Intergenic
1154000906 18:10481762-10481784 CAGGTGGGCCTGAGAATTTAGGG - Intronic
1156155737 18:34300169-34300191 CAGGTGGAACTTGAGTTTTGGGG + Intergenic
1156198382 18:34802174-34802196 CTGTTTGGCCTGAAGTTTTAGGG + Intronic
1156358788 18:36365535-36365557 CAGATGGGTATGAAGGTTTGGGG + Intronic
1156394957 18:36691130-36691152 CAGGTGGGCAGGAATTTGTGGGG - Intronic
1156723621 18:40100825-40100847 CAGGTGGACATGAATTTTTTAGG - Intergenic
1156760021 18:40577589-40577611 CAGATGAGCCTGTAGATTTGGGG - Intergenic
1157182339 18:45508966-45508988 CAGATGGATCTGAAGGTTTGGGG - Intronic
1157300174 18:46473417-46473439 CAGGTGGCCCTCAGGTTCTGGGG - Intergenic
1157750711 18:50175672-50175694 CAGGTGGGCAAGAAGTTTTAAGG + Intronic
1160578703 18:79871571-79871593 CAGGCGGGGCTGACGTCTTGCGG + Intronic
1160706919 19:534173-534195 TTGGGGGGCCTGAAGTCTTGGGG + Intronic
1160857277 19:1223293-1223315 CAGGTGGGCTGGAGGCTTTGGGG - Intronic
1161186795 19:2926677-2926699 CAGGTGCGCCTGCAGGTGTGAGG - Intergenic
1161228694 19:3161323-3161345 CAGGTGGACATGAATTTTGGGGG + Intronic
1161785329 19:6321552-6321574 CTGGTGGGGCTGATGTTCTGGGG - Intronic
1162404261 19:10464026-10464048 CATCTTGGCCTGAAGTTCTGAGG + Intronic
1162976300 19:14208516-14208538 CAGATATGCCTCAAGTTTTGTGG - Intergenic
1164529590 19:29038207-29038229 CAGCAGAGCCTGAAGCTTTGGGG - Intergenic
1165898062 19:39155236-39155258 CCCGTGGGCAGGAAGTTTTGTGG + Intronic
1166615094 19:44236613-44236635 CAGGTGGACTCGAAGATTTGAGG - Exonic
1166618592 19:44274051-44274073 CTGATGGGCTTGAAGATTTGAGG - Exonic
1167465201 19:49646857-49646879 CAGGTGGTCGTGGAGTTGTGTGG + Intronic
1202699118 1_KI270712v1_random:149925-149947 TTGGTGGGCCTGAAGTTCTTTGG - Intergenic
927290803 2:21403047-21403069 AAGGTGGGACTGAAGTCTTCAGG - Intergenic
927706356 2:25298855-25298877 CAGTTCTGCCTGAAGATTTGAGG - Intronic
932305374 2:70698145-70698167 CAGGTGGGGCTGATGTTGGGAGG + Intronic
932520067 2:72402900-72402922 CATGTAGAGCTGAAGTTTTGAGG + Intronic
934170068 2:89533411-89533433 TTGGTGGGCCTGAAGTTCTTTGG - Intergenic
934280369 2:91607719-91607741 TTGGTGGGCCTGAAGTTCTTTGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934927421 2:98391319-98391341 CAGGTGGGCAGGAGGCTTTGGGG + Intronic
935385895 2:102500021-102500043 CAGGTGAGCATGGATTTTTGAGG - Intronic
937789428 2:125943112-125943134 CAGGTGGGCCGGCAGTGCTGGGG + Intergenic
938971963 2:136440963-136440985 CAGGTGGCCCTAAATCTTTGCGG + Intergenic
941083672 2:161091593-161091615 GAGGTGTGCCTGAAGCTTGGGGG - Intergenic
941176541 2:162204356-162204378 CACGTGGACATGAATTTTTGGGG - Intronic
943325609 2:186493944-186493966 CAGGTGGACTTGAATTTTGGGGG + Intronic
944472826 2:200073143-200073165 CAGGTGGACATGAATTTTTGAGG + Intergenic
947580335 2:231312176-231312198 CAGCTGGGCCGGAAGGTTCGAGG + Intronic
948094932 2:235325773-235325795 CATGTGGGCATGAATTTTGGGGG - Intergenic
949047185 2:241877530-241877552 CAGGGGGCCCTGAAGTTTGCAGG + Intergenic
1171768891 20:29306697-29306719 CGGGCGGGTCTGAAGTTCTGGGG - Intergenic
1172976427 20:38909429-38909451 CAGGTAGACATGAATTTTTGAGG + Intronic
1173475739 20:43358083-43358105 CAGGTGAGCCTCAAGTTCAGAGG + Intergenic
1175465098 20:59185469-59185491 CAGGTTGGGCTAAAGTTTTTGGG + Intergenic
1175791963 20:61745559-61745581 CAGGTGGGGCTCATGATTTGGGG - Intronic
1175792079 20:61746122-61746144 CAGGTGGGGCTCACGATTTGGGG - Intronic
1176197399 20:63843815-63843837 CAGGTGGGGCTGCAGATGTGGGG - Intergenic
1179117569 21:38507899-38507921 CAGCTGGGACTTAAGTTGTGAGG + Intronic
1180784474 22:18539157-18539179 CTGGTGGGCCTGGAGCCTTGGGG + Intergenic
1180979769 22:19873028-19873050 CAGGTGGGGCTGCAGTTTGGTGG - Intergenic
1181241377 22:21478514-21478536 CTGGTGGGCCTGGAGCCTTGGGG + Intergenic
1181597261 22:23924216-23924238 CAGTGTGGCCAGAAGTTTTGTGG - Intergenic
1182318624 22:29464062-29464084 CAGCTGGGCCTGAAGAAATGGGG + Intergenic
1183397011 22:37577312-37577334 CAGGTGGACATGAATTTTCGGGG - Intronic
1183715191 22:39529309-39529331 CTGGTGGGCCGGAAGTCCTGGGG - Exonic
1185269559 22:49922810-49922832 CAGGGGGGCGTGAAGTGTGGGGG + Intronic
950255800 3:11504527-11504549 CAGCTGGGCCTGAAGCACTGAGG + Intronic
954916923 3:54156422-54156444 CAGCTGGGCAGGAAGTTCTGAGG - Intronic
956438829 3:69260447-69260469 CAGGTGGGCCAGCAGTGCTGGGG - Intronic
958580734 3:96017976-96017998 CACCTGGGCCTGGAGATTTGGGG + Intergenic
960205092 3:114887360-114887382 CAGGTGAACATGAAATTTTGGGG - Intronic
963290627 3:143483505-143483527 CAGGTCTGCCTCAGGTTTTGTGG + Intronic
964364477 3:155934587-155934609 TGGGTGGGCATGAAGTTTTGGGG + Intronic
966740841 3:183231938-183231960 CAGTGGGGCCAGAAGTCTTGGGG - Intronic
967990840 3:195129401-195129423 CAGGTGGTCCAGGAGTTTTGGGG - Intronic
969444222 4:7234942-7234964 AGGCTGGGCCTGAAGTCTTGTGG + Intronic
969865943 4:10077163-10077185 CAGGTGGCCCGGAAGAGTTGTGG - Intronic
970948843 4:21728413-21728435 CAGCTTGGCCTGCAGTTCTGGGG - Intronic
972636523 4:40889088-40889110 CAGCTGGGCCAGATGCTTTGGGG - Intronic
972913312 4:43846342-43846364 CAGGTGGGCCGGCAGTGCTGGGG - Intergenic
973742035 4:53927554-53927576 CAGGTGGGCCTGCAGGTGTGTGG + Intronic
976129712 4:81871182-81871204 CAGGTTGTCCTGAAGAGTTGAGG - Intronic
976827851 4:89280600-89280622 TAGGTGGACCTGAATTTTAGGGG - Intronic
977359083 4:95981055-95981077 CAGGAGGGCCTGAAGGCTGGGGG + Intergenic
978809098 4:112830980-112831002 CAGGTGGGCCAGCAGTGCTGGGG - Intronic
980532858 4:134076723-134076745 CATGTGGGTCTGGAGCTTTGAGG + Intergenic
980796490 4:137690833-137690855 CAGGTGGGCATGATTTTTTAGGG + Intergenic
981268536 4:142816922-142816944 CAGGTAGACATAAAGTTTTGGGG - Intronic
984189812 4:176592140-176592162 CAGGGGGGCTTGAGATTTTGGGG + Intergenic
990306118 5:54495503-54495525 CAGGTGGGGAACAAGTTTTGGGG - Intergenic
990389035 5:55299803-55299825 CAGGTGGACATGAATATTTGGGG + Intronic
992263137 5:74990593-74990615 CACGTGGCCCTGAAGTTTCCGGG + Intergenic
993742050 5:91553645-91553667 CAGGTGGACATGAATTTTGGAGG - Intergenic
997377971 5:133410971-133410993 CAGGTGGGCCTGAGGGTTCTGGG + Intronic
997601526 5:135141795-135141817 CAGGTGGCTCTGAGGTTTGGGGG + Intronic
998117547 5:139549517-139549539 CAGGTGGGCCTGCAGTGCTGGGG - Intronic
1000084752 5:157879455-157879477 CAGGTGGGCCGGCAGTGCTGGGG - Intergenic
1000085875 5:157887022-157887044 CAGGTGGGCCGGCAGTGCTGGGG - Intergenic
1003539160 6:7003019-7003041 GAGGTGGGTCAGAGGTTTTGAGG - Intergenic
1004483220 6:16040521-16040543 CAGGTGGGCCGGCAGTGCTGGGG + Intergenic
1004720791 6:18265935-18265957 CAGGTGGTCCTGACGAGTTGAGG + Intergenic
1005945319 6:30591050-30591072 CAGCTGGGCCTGAAGCTGTAGGG - Exonic
1006467121 6:34202576-34202598 AAGGAGGGCCTGAAGTCTGGGGG - Intergenic
1007693318 6:43716580-43716602 CAGGTGGGCATAAACTTTGGGGG - Intergenic
1007907393 6:45475985-45476007 CAAGTTGGCCTGAAGATTTTTGG - Intronic
1008230634 6:48982332-48982354 CAGGTGGACCTGATTTTTTGGGG + Intergenic
1008917767 6:56808167-56808189 TAGGTGGGCCAGAAGTCATGGGG - Intronic
1008960395 6:57260333-57260355 CATGTGGTCCTGAAGAGTTGTGG + Intergenic
1010089294 6:71961067-71961089 CAGGTGGGAAAGAAGTATTGAGG + Intronic
1016779618 6:147943558-147943580 CAGGTGGGGCTGCAGCTTTCTGG - Intergenic
1017237445 6:152131635-152131657 GTGGTGGTCCTGAAGGTTTGCGG - Intronic
1018189363 6:161295334-161295356 CAGGAGAGCCTGTAGTTTTTAGG - Intergenic
1018568660 6:165184301-165184323 CAGGTGGACATGAATTTTGGAGG + Intergenic
1020110529 7:5445501-5445523 CAGGTGGACAGGAAGTTTTGGGG - Intronic
1020637855 7:10718046-10718068 CAGGAAGGCCTGGACTTTTGGGG - Intergenic
1021065754 7:16170767-16170789 CAGGTGGGCCAGCAGTGCTGGGG + Intronic
1021100666 7:16584222-16584244 CTGGTGGGCATGAAGCTGTGTGG + Intergenic
1021723988 7:23532171-23532193 GAGGTGAGTCTGAAGTTTGGAGG - Intergenic
1021906402 7:25338531-25338553 GTGGTGGGCCTGGAGTTTTGAGG + Intergenic
1027460416 7:78445598-78445620 CAGGTGAACCTAAACTTTTGTGG - Intronic
1028898619 7:96070327-96070349 TGTGTGAGCCTGAAGTTTTGGGG + Intronic
1028972337 7:96872713-96872735 CAGGTGGACATGAATTTTGGGGG + Intergenic
1031085551 7:117298659-117298681 CAGGTGGGCCTGAAACTTCCAGG + Intronic
1031096861 7:117430438-117430460 CAGGTGGACATGAAATTTTGGGG + Intergenic
1031607341 7:123785295-123785317 CAGGTTGGCCTCAAACTTTGGGG + Intergenic
1032515672 7:132504376-132504398 CAGGTGGCCCAGGAGTTTTGCGG + Intronic
1033472941 7:141665429-141665451 CAGGTGGTCCTGGCGTTCTGAGG + Intronic
1033563606 7:142557855-142557877 CAGGGTGGCCTGCAGTTTGGAGG + Intergenic
1034503460 7:151467340-151467362 CGGGGGGCCCTGAAGTTCTGGGG - Intronic
1042916402 8:73879284-73879306 CAGCTGCGCATGAAGTTTTATGG - Intergenic
1044529109 8:93288271-93288293 CAAGTGGGCCTGAGGTTGTCAGG - Intergenic
1047141290 8:122142574-122142596 CAGGTGGGCCTGGACTTTGGGGG - Intergenic
1047431917 8:124800115-124800137 CAGGTGAACATGAATTTTTGGGG - Intergenic
1049190227 8:141283389-141283411 GAGGTAGGCCTGGAGCTTTGGGG - Intronic
1049603257 8:143517824-143517846 CAGGTGGGCCTGGAGATTCGGGG - Intronic
1050588009 9:7133293-7133315 CAAGTAGGCATGAAGTTCTGAGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055515901 9:77032600-77032622 CAGGTGCCCCTGAGGTTCTGAGG + Intergenic
1056378286 9:86035348-86035370 AAGGTGGGTGTGAAGTTTCGGGG - Exonic
1060309017 9:122442633-122442655 AAGGTGGGCATAAATTTTTGGGG + Intergenic
1060903109 9:127279053-127279075 CAGGTGGACCTGAATTTGGGGGG + Intronic
1061508987 9:131049030-131049052 CTGGTGGGCCAGAAGTGTGGGGG + Exonic
1062482952 9:136760840-136760862 CAGGTGGGCCTGAAGTTTTGGGG - Intronic
1203362576 Un_KI270442v1:230849-230871 CGGGCGGGCCTGCAGTTGTGGGG - Intergenic
1190302712 X:49065765-49065787 CAGGAGTGCCTCCAGTTTTGAGG + Exonic
1190725809 X:53189912-53189934 CAGTTGGGCCTGAAGGGTTTGGG + Intergenic
1194173476 X:90617944-90617966 CAGGCGGGCCGGCAGTGTTGAGG + Intergenic
1198512857 X:137371670-137371692 CAGGAGAACGTGAAGTTTTGGGG + Intergenic
1200519696 Y:4195636-4195658 CAGGCGGGCCGGCAGTGTTGAGG + Intergenic
1201424253 Y:13831521-13831543 CAGGTGGGCCGGCAGTGCTGCGG - Intergenic
1201479939 Y:14428263-14428285 CAGGTGGGCCGGCACTTCTGGGG - Intergenic