ID: 1062483848

View in Genome Browser
Species Human (GRCh38)
Location 9:136764564-136764586
Sequence GCCCAGGAGCAGGTGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 7, 3: 44, 4: 389}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062483848_1062483854 -2 Left 1062483848 9:136764564-136764586 CCTGGGTGCACCTGCTCCTGGGC 0: 1
1: 0
2: 7
3: 44
4: 389
Right 1062483854 9:136764585-136764607 GCGGAGCAGATGGAAGCGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 364
1062483848_1062483853 -6 Left 1062483848 9:136764564-136764586 CCTGGGTGCACCTGCTCCTGGGC 0: 1
1: 0
2: 7
3: 44
4: 389
Right 1062483853 9:136764581-136764603 CTGGGCGGAGCAGATGGAAGCGG 0: 1
1: 0
2: 5
3: 47
4: 369
1062483848_1062483855 6 Left 1062483848 9:136764564-136764586 CCTGGGTGCACCTGCTCCTGGGC 0: 1
1: 0
2: 7
3: 44
4: 389
Right 1062483855 9:136764593-136764615 GATGGAAGCGGAAGGCACTTCGG 0: 1
1: 0
2: 1
3: 10
4: 144
1062483848_1062483856 20 Left 1062483848 9:136764564-136764586 CCTGGGTGCACCTGCTCCTGGGC 0: 1
1: 0
2: 7
3: 44
4: 389
Right 1062483856 9:136764607-136764629 GCACTTCGGCTCTGAGACTCCGG 0: 1
1: 0
2: 0
3: 3
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062483848 Original CRISPR GCCCAGGAGCAGGTGCACCC AGG (reversed) Intronic
900093193 1:929476-929498 GCTCAGGGGCAGCTGCAGCCTGG - Intronic
900101419 1:963721-963743 GCCCAGGTGGGTGTGCACCCAGG + Intronic
900242540 1:1623953-1623975 GCACAGGAGCCGGTGCGGCCCGG - Intronic
900284286 1:1891587-1891609 GGGCAGGCGCAGGTGCCCCCCGG + Intergenic
900356616 1:2268121-2268143 GCCCTGGCCCAGGTGCCCCCTGG + Intronic
900609261 1:3537548-3537570 GCCCAGGGCCCGGTGCCCCCCGG - Intronic
901257632 1:7844749-7844771 CGCCAGCAGCAGGTGCAACCTGG - Exonic
901825548 1:11858789-11858811 GAGCAGGAGCAGGAGCGCCCGGG + Exonic
902176579 1:14655106-14655128 GGCCAGGAGCAGCAGCACCACGG - Intronic
902548508 1:17205487-17205509 GCCCAGGAGCTGGGGCCCCAAGG - Intronic
902582633 1:17418108-17418130 ACCAAGGAGCAACTGCACCCTGG + Intronic
902731616 1:18373636-18373658 GCCCAGGAGCCGGGGTGCCCTGG + Intronic
903163705 1:21506997-21507019 AGCCAGGAGGAGGGGCACCCGGG + Intergenic
903667920 1:25019119-25019141 GCCCAGGAGCTGGCGCACAGTGG + Intergenic
903757933 1:25676051-25676073 GACCAGGAGTAGGGCCACCCAGG - Intronic
903861512 1:26367556-26367578 TGCCAGGCGCAGGTGCAGCCCGG + Intronic
904751149 1:32741988-32742010 GCCGAGGAGCCGGGGAACCCGGG + Exonic
905246003 1:36614433-36614455 ACACAGGTGCAGGTGCACCCAGG + Intergenic
905344880 1:37304558-37304580 GGGCTGGAGCAGGTGCAACCTGG + Intergenic
905443459 1:38009199-38009221 GCCCAGGAGGACGTGCCCCAGGG + Intergenic
906078547 1:43069030-43069052 GGCCATGAGCAGGGGGACCCTGG - Intergenic
913194685 1:116445738-116445760 GCCCAGGGTCAGGTGCAGCTAGG - Intergenic
913452539 1:119001717-119001739 CCCCAGGAGCAGGGGGATCCAGG + Intergenic
914022818 1:143885077-143885099 GCCCGGGAGCAGGCGGGCCCGGG - Intergenic
914045317 1:144086542-144086564 CACCAGGGGCAGGTGCACCCTGG - Intergenic
914132793 1:144874144-144874166 CACCAGGGGCAGGTGCACCCTGG + Intergenic
914517254 1:148384474-148384496 GCCCTGGCGCAGGGGCACCAGGG + Intergenic
915081354 1:153354778-153354800 GCCCAGGCGCAGGTGAGGCCAGG - Intergenic
915631910 1:157159276-157159298 GCACAGGAGCAGGCACAGCCTGG - Intergenic
918345589 1:183604596-183604618 GCCCAGGAGAAGGGCAACCCTGG + Intergenic
919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG + Intergenic
920674824 1:208031552-208031574 GCTCAGCAGGAGGTGCAGCCTGG - Intronic
921081410 1:211741265-211741287 GCCCAGGAGCAGCAGAACCGGGG - Intergenic
922675155 1:227545025-227545047 ACCCAGGGGCAGATGCACTCAGG - Intergenic
922809234 1:228406695-228406717 GCCCCGGAGCCCGAGCACCCGGG - Exonic
923095277 1:230770555-230770577 CCCCAGGATCAGTTCCACCCTGG - Intronic
923105470 1:230850614-230850636 GGCCAAGAGCAGGGGCACACAGG + Intronic
1064855069 10:19757839-19757861 GCCCAGGAGTAAGTTCAGCCTGG - Intronic
1065223269 10:23517830-23517852 GCCGAGAAGCAGGTGTACCTGGG + Intergenic
1066957422 10:42186234-42186256 CACCAGGTGCAGGTGCACCATGG - Intergenic
1067552816 10:47247232-47247254 ACCCAGGGGCTGGTGCACCAGGG + Intergenic
1067724696 10:48761203-48761225 GGCCAGGAGCAAGGGCTCCCTGG + Intronic
1069877837 10:71574057-71574079 GCCCAGGCTGAGATGCACCCTGG + Intronic
1069901713 10:71710389-71710411 GCCCAGGAGCAGGAGGGCCCAGG - Intronic
1070351266 10:75594147-75594169 GCCCATCAACAGGGGCACCCGGG - Intronic
1070502992 10:77089093-77089115 GCACAGGAGCAGGTACCCACAGG - Intronic
1070645564 10:78199860-78199882 GGCTGGGAGCAGGAGCACCCAGG - Intergenic
1070859414 10:79638596-79638618 GCCCAGGTGCTGTTGCAGCCTGG - Intergenic
1071974035 10:90937321-90937343 GCCCAGGAGCAGGAGCTCAAAGG - Intergenic
1074983731 10:118639849-118639871 GCTCAGGAGTAGGTGCACTGGGG - Intergenic
1075729540 10:124628069-124628091 GCCCAGGAACAGCAGCACCTGGG - Intronic
1075949223 10:126462771-126462793 GCCCAGGAGAGGGAGGACCCAGG - Intronic
1076560805 10:131362103-131362125 GCCTAGGAGCTGGGGCACCTGGG - Intergenic
1076824151 10:132958891-132958913 GCTCAGGAGCAGGAGCTCCTGGG - Intergenic
1077223067 11:1425891-1425913 GCCCCGGGGCAGGTGTACCCAGG - Intronic
1077402119 11:2364126-2364148 GCCCCGGGGGAGGTGCTCCCAGG + Intergenic
1080868407 11:36215144-36215166 GCCCTGTAGCAGGTGCATGCTGG + Intronic
1080889654 11:36398378-36398400 GCGCTGTAGCAGGTGAACCCAGG + Intronic
1081704933 11:45177139-45177161 GCCCAGGAGCCAGTGTAGCCAGG - Intronic
1081789039 11:45769764-45769786 GGAGAGGAGCAGGGGCACCCAGG + Intergenic
1081967044 11:47176536-47176558 GCCCAGGGAGCGGTGCACCCCGG + Exonic
1082015004 11:47478837-47478859 GCAGAGGAGCAGCAGCACCCAGG - Intronic
1082996943 11:59262393-59262415 CTCCAGCAGCAGCTGCACCCTGG - Intergenic
1083652489 11:64211432-64211454 GCTCCACAGCAGGTGCACCCAGG + Exonic
1083796837 11:65021782-65021804 GCCCGGCAGCAGGTTCTCCCCGG - Exonic
1084651563 11:70492352-70492374 GCCCAGCAGCCGGTGCTTCCCGG - Exonic
1084675128 11:70629715-70629737 GCTCTGCAGCAGGTGCTCCCTGG - Intronic
1084709082 11:70832841-70832863 CCCCACGAGCAGGTGCAGCCAGG + Intronic
1087812475 11:102623255-102623277 GCCCAGGATCAGGGGACCCCTGG - Intronic
1089582807 11:119492062-119492084 GCCTGGGAGCAGGTGGACCTGGG - Intergenic
1090388718 11:126373361-126373383 GACCTGGAGCAGGTCCACACAGG + Intronic
1091231207 11:133989033-133989055 GCCCAGGAGCAGCGTCCCCCCGG + Intergenic
1094548994 12:31432078-31432100 GTGCAGGAGGAGGTGGACCCTGG + Intronic
1095945769 12:47752375-47752397 GCCCAGGAGCGGATGTTCCCAGG - Intronic
1098906864 12:76171290-76171312 GCCCAGGAGAAGTTGAACCTTGG - Intergenic
1101788790 12:107910189-107910211 GCCCAGGATCAAGTGGCCCCAGG - Intergenic
1101836636 12:108300229-108300251 CTCCAGGAGCAGGTGCGCCAGGG + Intronic
1102001376 12:109559834-109559856 GCCCAGGAGGGTGTGCACCCAGG + Intronic
1102064381 12:109961414-109961436 TCCCAGGAGCAGTGGCACACAGG - Intronic
1103840082 12:123855843-123855865 TCCTAGGAGCAGGCCCACCCTGG + Intronic
1103853828 12:123950821-123950843 GCCAAGGAGGATGTGCACACAGG - Intronic
1104468447 12:129008678-129008700 CCCCAGGAGCAGATGCTACCAGG + Intergenic
1104658338 12:130590925-130590947 GCCCCAGAGCAAGTGCAGCCAGG + Intronic
1104702987 12:130921382-130921404 TCCCAGAAGCAGGTGCTGCCAGG - Intergenic
1104981950 12:132577161-132577183 CCCCAGGCCCAGGTCCACCCTGG - Intronic
1105211295 13:18258601-18258623 TCCCAGGAGAAGTTGTACCCTGG + Intergenic
1105498742 13:20953196-20953218 GCCCCGGAGCAAGTGCCCCCCGG + Intergenic
1106409939 13:29504575-29504597 GTCCAGGAGCTGGTGCCCCCTGG - Exonic
1107437375 13:40391981-40392003 GCCCCGGAGCAGCTGCACTTTGG + Intergenic
1107872395 13:44759512-44759534 GCCCAGGTGCAGGTTGACACTGG + Intergenic
1109396563 13:61766491-61766513 GCCCAGGAGCTGTTGCAACCCGG - Intergenic
1112639642 13:101258390-101258412 GGCAAGGAGCAGGTGAACCGCGG - Intronic
1113185471 13:107681947-107681969 TCCCAGGAGCATGTGCACGTTGG + Intronic
1113488901 13:110676878-110676900 GCATGGGAGCAGGTGCAGCCTGG - Intronic
1113502968 13:110793014-110793036 GGGCAGGTGCAGTTGCACCCAGG - Intergenic
1113807168 13:113116627-113116649 CCCCAGGAGCAGGAGCTCCCAGG - Intronic
1114216263 14:20659906-20659928 GACGAGGAACAGGTGCAGCCAGG + Intergenic
1117195974 14:53340647-53340669 GGCCAGGAGGAGGGGCACCAAGG + Intergenic
1117733950 14:58751034-58751056 GCCCAGGAGCTGTTGCAACCTGG + Intergenic
1119111898 14:71982576-71982598 TCCAAGGAGGAGGGGCACCCAGG - Intronic
1119866865 14:77981329-77981351 TCCCAGGAGCAGCGGCTCCCGGG + Intergenic
1121335515 14:93075580-93075602 TCCCAGGAGCAGGGGAAACCTGG + Intronic
1121524815 14:94612549-94612571 GGCCAGGAGGAGGTGTACTCAGG + Intronic
1121685517 14:95832331-95832353 GCCGGGGAGGAGGAGCACCCTGG - Intergenic
1122044251 14:99012101-99012123 GCCCAAGAGCAGGTGCAACCCGG + Intergenic
1122817312 14:104320098-104320120 GCCGAGGGGCTGGTGCATCCCGG - Intergenic
1122898624 14:104772806-104772828 GCGCAGGGGCAGGTGCAGCCTGG + Intronic
1122983622 14:105202424-105202446 GCCCTGGAGCAGGCGCACCTAGG + Intergenic
1202858377 14_GL000225v1_random:65026-65048 GCACTGCAGCAGGTGCAGCCAGG + Intergenic
1202865312 14_GL000225v1_random:113749-113771 GCACTGCAGCAGGTGCAGCCAGG - Intergenic
1202935677 14_KI270725v1_random:85545-85567 CACCAGGGGCAGGTGAACCCTGG + Intergenic
1123493074 15:20798568-20798590 GCCCAGGAGCTGGAGCCCTCCGG + Intergenic
1123549580 15:21367670-21367692 GCCCAGGAGCTGGAGCCCTCCGG + Intergenic
1124617819 15:31255236-31255258 AGCCAGGAGCAGGGGCAGCCAGG + Intergenic
1126713100 15:51483501-51483523 GCTCAAGGGCAGGTTCACCCTGG - Intronic
1126974198 15:54156209-54156231 CTCCAGAAGCAGGTGCACTCAGG + Intronic
1128106549 15:65049760-65049782 ACCCAGGAGCACGTGGAGCCTGG - Intronic
1128480351 15:68032238-68032260 GCCAAGGAGCAGGTGGAAGCAGG - Intergenic
1129249961 15:74303312-74303334 GCCTGGGAGCAGGGTCACCCAGG + Intronic
1129499656 15:76023857-76023879 GCTCAGCAGCGGGTTCACCCTGG - Intronic
1129683312 15:77670763-77670785 GCCCAGCAGCAGCTGGCCCCTGG - Intronic
1130273913 15:82466706-82466728 GCACAGTCGCAGCTGCACCCTGG + Intergenic
1130466261 15:84194080-84194102 GCACAGTCGCAGCTGCACCCTGG + Intergenic
1130498003 15:84479456-84479478 GCACAGTCGCAGCTGCACCCTGG - Intergenic
1130588555 15:85198673-85198695 GCACAGTCGCAGCTGCACCCTGG + Intergenic
1131152903 15:90058077-90058099 GGTCAGGTGTAGGTGCACCCGGG + Intronic
1202957911 15_KI270727v1_random:94888-94910 GCCCAGGAGCTGGAGCCCTCCGG + Intergenic
1132528121 16:427467-427489 CCCCAGGAGCAGGTGCCCTGAGG - Intronic
1132670673 16:1101040-1101062 GCCCAGGAGCAGGAGCCCCCGGG - Intergenic
1132763023 16:1520114-1520136 GCCCAGGTGCAGGCCCTCCCTGG - Exonic
1132974618 16:2705141-2705163 GACGAGGACCAGGGGCACCCAGG + Intronic
1133208006 16:4245600-4245622 TCCCCGGAGCATGTGCTCCCAGG - Intergenic
1133326059 16:4943121-4943143 GTCCAGGAGCAGGCTGACCCAGG - Intronic
1136637892 16:31537472-31537494 GCCCAGGAGCAGCCGGGCCCAGG + Intergenic
1137977868 16:53046263-53046285 GACAAGCAGCAGGAGCACCCAGG + Intergenic
1138348399 16:56333753-56333775 GTCCTGGAGCAGATGCAGCCTGG + Intronic
1139331505 16:66195914-66195936 GCACAGCTGCAGGAGCACCCTGG - Intergenic
1139432175 16:66916912-66916934 GCCCAGGAGCAGACTCACACTGG + Intronic
1141593296 16:85082699-85082721 GCCCAGACGCAGGTGCAGCCTGG + Intronic
1141624613 16:85254673-85254695 GCCCAGGAGCACGGTCATCCTGG - Intergenic
1141718524 16:85741438-85741460 GACCAGGAGCAGCTCCAGCCAGG + Intronic
1141852161 16:86653852-86653874 TCCCAGGAGCTGCTGCAGCCGGG - Intergenic
1142178401 16:88655629-88655651 GGCCAGGAGCGGGTGGTCCCGGG - Intronic
1142226111 16:88878369-88878391 GCCCAGGCACAGATGCACACAGG + Intronic
1142676897 17:1519196-1519218 TCCCATTAGCAGATGCACCCAGG + Exonic
1142717667 17:1755776-1755798 GCCCAGGAGCTGGGGCAGCGTGG + Intergenic
1143129003 17:4664319-4664341 GCTGAGGAGCAGCTGCTCCCTGG + Intergenic
1144500554 17:15783042-15783064 GCCCCGGAGCAGCTGAACCGGGG + Intergenic
1145738079 17:27247550-27247572 GCCCAGGGCCTGGTGCATCCTGG + Intergenic
1146274677 17:31509321-31509343 CCCCAGGAGCGGGGGCAACCGGG - Intronic
1146283048 17:31557812-31557834 GTCCAGGAGCTGGTGCTCCCAGG - Intergenic
1146774151 17:35597071-35597093 GCCCCGGAGCGGGGGCGCCCAGG - Intronic
1147557298 17:41487538-41487560 GCCCAGGAGCCTGTGGTCCCAGG + Intronic
1147651197 17:42062869-42062891 GCCCAGGCCCAGGTGCACTGTGG - Exonic
1148063705 17:44853572-44853594 GCCCAGGAGCCCCTGCACCGGGG - Exonic
1149082695 17:52677761-52677783 GCTCAAGGGCAGGTTCACCCTGG - Intergenic
1149243093 17:54673702-54673724 TCCCTGGATCAGGAGCACCCTGG + Intergenic
1149535709 17:57431836-57431858 GCCCAAGTGCAGGTGGACACTGG - Intronic
1149996690 17:61409565-61409587 GCCCGGCGGCAGCTGCACCCCGG + Intergenic
1150249590 17:63698568-63698590 GCCCACAAGGAGGTGGACCCCGG - Exonic
1150520969 17:65866240-65866262 GCCCAGGTGCTGTTGCAGCCTGG + Intronic
1150824405 17:68461912-68461934 GCCGAGCAGCAGGTGCAACTGGG + Intergenic
1151515510 17:74592497-74592519 GCCAAGGAGCAGGAGGAGCCAGG + Exonic
1151890702 17:76949120-76949142 GCCCAGGAGCAGGTGGTCGGAGG + Exonic
1152226729 17:79096245-79096267 GCCCTGGAGCACAGGCACCCAGG + Intronic
1152364560 17:79847910-79847932 GCACAGGGGCAGGTGGACTCTGG - Intergenic
1152524388 17:80879299-80879321 GCCCAGCAGGAGCTGCAGCCGGG - Intronic
1152576607 17:81143933-81143955 CCACAACAGCAGGTGCACCCAGG + Intronic
1152615813 17:81337288-81337310 GCCCAGGTGCAGGAGCACGGGGG - Intergenic
1152701620 17:81822569-81822591 GCCCCTGGGCAGGGGCACCCAGG - Exonic
1152718977 17:81913512-81913534 GGCCTGGAGCAGGAGCACGCGGG + Intronic
1152739149 17:82011471-82011493 GCCCAGGTGCTGGGGCAGCCCGG + Intronic
1152768311 17:82152691-82152713 GGCCAGGGCCAGGTGCAGCCTGG - Intronic
1152841384 17:82570957-82570979 GCCCATGAGGAGGAGCCCCCTGG - Intronic
1152878838 17:82804008-82804030 CCCCACAGGCAGGTGCACCCCGG - Intronic
1154018180 18:10638456-10638478 GCCCAGCTGCAGCTGCACTCAGG - Intergenic
1154066434 18:11111126-11111148 GCCCAGGAGCAGGAGCACTGGGG + Intronic
1154380279 18:13843468-13843490 GTCCAGGATCAGGTGCTTCCAGG + Intergenic
1154450614 18:14473101-14473123 GCCCAGGAGCTGGAGCCCTCCGG + Intergenic
1156445662 18:37235139-37235161 CCCCTGGAGTAGGTGGACCCTGG + Intergenic
1157753106 18:50195281-50195303 GCGCAGGCACAGGTGCGCCCCGG + Intergenic
1158345170 18:56508888-56508910 GTCCAGGAAGAGGTCCACCCTGG - Intergenic
1159020921 18:63142433-63142455 GTCGAGGACCAGATGCACCCCGG + Intronic
1159940137 18:74400558-74400580 GGCCCGGGGCAGGTGCACTCAGG - Intergenic
1160316907 18:77857065-77857087 ATGCAGGAGCAGGTGCGCCCAGG + Intergenic
1160534279 18:79584056-79584078 GCCCACGCCCAGGAGCACCCTGG - Intergenic
1160534297 18:79584095-79584117 GCCCACGCCCAGGAGCACCCGGG - Intergenic
1160717626 19:583534-583556 TTCCGAGAGCAGGTGCACCCTGG + Intergenic
1160822870 19:1066580-1066602 GCCCAGGACCAGGTGGACGTGGG + Intronic
1160839814 19:1141115-1141137 GCCCCGGAGAAGAGGCACCCTGG + Intronic
1160860463 19:1235326-1235348 GCCCAGGCGTAGGTGGGCCCAGG - Intronic
1160921752 19:1523995-1524017 GCCCGGGCGCAGGTCCAGCCCGG - Intergenic
1160946644 19:1646929-1646951 GCCCTGGAGCAGGGGGTCCCTGG + Intronic
1161137252 19:2627019-2627041 TCCCAGGAGCTGGGGCTCCCGGG - Intronic
1161212589 19:3075333-3075355 TCCCAGGAGCTGGGGCCCCCTGG - Intergenic
1161243897 19:3238362-3238384 ACCCAGGAGGAGGTGCACTTTGG - Intronic
1161668413 19:5590633-5590655 CCCCAGGAGCCAGGGCACCCTGG + Intronic
1162516172 19:11149172-11149194 GCGAAGGAGCAGGTGCACCAGGG - Exonic
1163551423 19:17967978-17968000 GCCCAGGAGCCAGTGCAGCAAGG - Intronic
1163685259 19:18708815-18708837 GCCCAGAAGCAGGAGGACCCTGG + Intronic
1164305970 19:24004015-24004037 GCCCAGGCCCAGGCGAACCCTGG + Intergenic
1165315027 19:35049495-35049517 GACCAGGAGCCGCTGTACCCAGG + Exonic
1165948482 19:39459221-39459243 ACCCAGCAGCAGCTGCTCCCAGG + Exonic
1166876868 19:45902679-45902701 GCCAAGGCGCAGGCGCGCCCAGG + Intergenic
1167045913 19:47048512-47048534 GCCCCGGAGCGGGGGCGCCCGGG - Exonic
1167292970 19:48634755-48634777 GACCTGGAGCAGGTGTGCCCAGG + Intronic
1167327239 19:48834322-48834344 GCCCTGGAGCAGGAGCTCCCTGG - Exonic
1167465550 19:49649348-49649370 ACCCAGCAGCAGGTGCAGCCTGG + Intronic
1167606468 19:50483521-50483543 GACCAGGAGGTGGTGCACCGTGG + Exonic
1168640645 19:58029274-58029296 ACCCAGGAGCAGCTGCACTTAGG + Intergenic
1202684875 1_KI270712v1_random:39946-39968 CACCAGGGGCAGGTGCACCCTGG - Intergenic
925056901 2:863256-863278 TGCCTGGAGCAGGAGCACCCTGG - Intergenic
925147257 2:1589363-1589385 GCCCAGGAGCAGGCGCCCAGTGG + Intergenic
927139342 2:20119058-20119080 GCCCAGAAACAGGGACACCCTGG + Intergenic
927524028 2:23721103-23721125 GCTCAAGAGCAGTTTCACCCTGG - Intergenic
927905095 2:26849613-26849635 GCCCAGCAGCAGGTGCTGCCAGG + Intronic
928854830 2:35790675-35790697 GCCCAGGCTCACTTGCACCCAGG + Intergenic
929443608 2:41985711-41985733 GCCCAGGTGCAGGTGGACATTGG + Intergenic
929872859 2:45773221-45773243 CCCCAGGAGAAGGGTCACCCAGG + Intronic
931684969 2:64785027-64785049 CACCAGGAGCAGCTGCACCAAGG + Intergenic
932450838 2:71809796-71809818 GCAGAGAAGCAGGTGCTCCCTGG + Intergenic
932770767 2:74499662-74499684 GCGCAGGAGGAGGGGCACACGGG - Exonic
934246844 2:90314900-90314922 CACCAGGGGCAGGTGCACCCTGG + Intergenic
934262482 2:91487703-91487725 CACCAGGGGCAGGTGCACCCTGG - Intergenic
934305529 2:91818692-91818714 CACCAGGGGCAGGTGCACCCTGG - Intergenic
934327727 2:92034056-92034078 CACCAGGGGCAGGTGCACCCTGG + Intergenic
934466113 2:94264586-94264608 CGCCAGGGGCAGGTGCATCCTGG + Intergenic
934777664 2:96949512-96949534 CCCCAGGAGGAGCTGGACCCAGG - Intronic
935414562 2:102802057-102802079 AACTAGGAGCAGGTGCAGCCTGG + Intronic
935435686 2:103029572-103029594 GCCCAGAGGCAGGTACCCCCGGG - Intergenic
935649876 2:105373099-105373121 GCAGAGGACCAGGTGCACCTCGG + Intronic
936556949 2:113504047-113504069 GCCCAGGAACAGGTGCACCAGGG + Intergenic
936628910 2:114178994-114179016 GCCCAGGAGGAGGAGCAGCAGGG + Intergenic
937205792 2:120236440-120236462 GCCCAGGTGCAGCTGCCCCTTGG + Intergenic
937456115 2:122042992-122043014 CCCCAGCAGCAGGTGGACACTGG - Intergenic
937954963 2:127416982-127417004 GCCCAGGGGCAGGTACACATAGG - Intergenic
941130985 2:161650681-161650703 GCCCAGGTGCGGTTGCAACCTGG + Intronic
942044195 2:172089951-172089973 GCTCAGGAACAGGTGCATCAGGG + Intergenic
945395236 2:209307834-209307856 GCACAGCTGCAGCTGCACCCTGG + Intergenic
946334018 2:219025675-219025697 GCCCAGGACTTGGGGCACCCAGG + Intronic
947726926 2:232406905-232406927 GCCCAGCAGGAGCAGCACCCAGG - Exonic
947736075 2:232456210-232456232 GCCCAGCAGCAGCAGCACCCAGG - Exonic
947956907 2:234200056-234200078 ACCCTGGAGCAGGTTCACCCTGG + Intergenic
948384756 2:237574605-237574627 CCCCAGAAGCAGGTGGGCCCAGG + Exonic
948387829 2:237592631-237592653 GCTCAGGAGCTGGTGCAGGCAGG + Intronic
948784979 2:240347608-240347630 GGCCAGGAGCAGGGACACTCAGG + Intergenic
948788127 2:240363615-240363637 GGCCAGGAGCTCGTGCTCCCAGG - Intergenic
948887121 2:240889943-240889965 GCCCAGGGGTAGGTGCACCCAGG - Intronic
949017805 2:241723333-241723355 CCCCAGGAGAAGGTGCTCCATGG + Intronic
949060489 2:241953777-241953799 GGCCTGGAGCAGATGTACCCAGG + Intergenic
1170511209 20:17078668-17078690 GCTCAGAAGCAGGTGCAGTCAGG + Intergenic
1170607053 20:17882386-17882408 GCGCAGGAGCAGGTTTCCCCAGG - Intergenic
1171284793 20:23928304-23928326 GTGCAGGACCAGGTGCACTCAGG - Intergenic
1174451666 20:50624472-50624494 TCCCGGGAGCAGGTGCATCCAGG - Intronic
1174580637 20:51569113-51569135 GCCCAGGAGCAGGAACACCAAGG - Intergenic
1174906925 20:54561513-54561535 GCCCAGCAACAGGTGAAGCCTGG + Intronic
1175689167 20:61053238-61053260 GCCCAGGGGCAGATGCGGCCAGG - Intergenic
1175963746 20:62649807-62649829 GGCCAGATGCAGGTGAACCCCGG - Intronic
1176080411 20:63269770-63269792 GGCCAGGACCAGGTGGGCCCTGG - Intronic
1176145079 20:63561909-63561931 AACCAGGAGCAGGTGCAGCCCGG - Exonic
1176288976 21:5034245-5034267 GCCCAGGAGAAGGGGTTCCCCGG + Intronic
1176445581 21:6817281-6817303 GCCCAGGAGCTGGAGCCCTCCGG - Intergenic
1176604823 21:8820192-8820214 GCCCAGGGGCGGCTGCACCGGGG + Intergenic
1176823748 21:13682314-13682336 GCCCAGGAGCTGGAGCCCTCCGG - Intergenic
1178488852 21:33035268-33035290 ACCCAGCAGCAGCTGCACTCTGG - Intergenic
1179277356 21:39904538-39904560 GCCCAGGAGCAAGATCAGCCAGG - Intronic
1179325513 21:40339299-40339321 GCCCACGATCACGTGGACCCTGG - Exonic
1179411692 21:41167881-41167903 GGGCAGGCGCAGGTGGACCCCGG + Exonic
1179801544 21:43813580-43813602 GGCCAGGAGCAGGTGGTGCCGGG + Intergenic
1179868258 21:44229359-44229381 GCCCAGGAGAAGGGGTTCCCCGG - Intronic
1180347113 22:11711797-11711819 GCCCAGGGGCGGCTGCACCGGGG + Intergenic
1180354863 22:11829887-11829909 GCCCAGGGGCGGCTGCACCGGGG + Intergenic
1180383388 22:12162444-12162466 GCCCAGGGGCGGCTGCACCGGGG - Intergenic
1180587241 22:16903753-16903775 CACCAGGGGCAGGTGCACCCTGG + Intergenic
1180797037 22:18610995-18611017 GCCGAGGAGCTGGTGAACCGCGG - Exonic
1180875923 22:19175242-19175264 GCCCAGGAGATGGAGCCCCCAGG - Intergenic
1180960172 22:19758983-19759005 ACCCAGGTGCAGGGGCAGCCAGG + Intronic
1181224687 22:21384276-21384298 GCCGAGGAGCTGGTGAACCGCGG + Exonic
1181253945 22:21550537-21550559 GCCGAGGAGCTGGTGAACCGCGG - Exonic
1181634821 22:24169660-24169682 GCCCAGGCCCAGGTCCACCAGGG + Intronic
1181648674 22:24247220-24247242 GCCCAGCACCAGGGGCACTCTGG - Intergenic
1182149917 22:28020679-28020701 GCCAGGGAGCAGCTGCACACAGG - Intronic
1182320110 22:29473271-29473293 GCCCAGGGGCAGCTGCACCCTGG - Intergenic
1183430954 22:37765525-37765547 GAGCAGGAGCAGGTGCAGACTGG + Intronic
1183457401 22:37930248-37930270 CCCCACAAGCAAGTGCACCCGGG - Intronic
1183693388 22:39404216-39404238 GCCCTGGAAGAGGGGCACCCTGG + Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184286213 22:43473205-43473227 GCCCAGCAGCACGGGCACCGTGG - Intronic
1184370184 22:44077035-44077057 GCCAAGCAGCAGGTGCAACCGGG + Intronic
1184470368 22:44692423-44692445 CCCCAGGAGGAGGAGCCCCCGGG - Intronic
1184742880 22:46439323-46439345 GCCGATGAGCAGGTTCACGCAGG + Exonic
1184773054 22:46609269-46609291 AGCCAGGAGAAGGTGGACCCAGG - Intronic
1184783634 22:46661431-46661453 GCAATGGAGCAGGTACACCCTGG + Exonic
1184815222 22:46863785-46863807 GGCCAGAAGCAGGTGCAACCCGG - Intronic
1184872223 22:47248005-47248027 GCCCAGGTGCAGCTGCAACAAGG - Intergenic
1185108162 22:48885797-48885819 GCCCAGGACCTGCTGCTCCCTGG + Intergenic
1185322717 22:50209308-50209330 CCCCTGGAGCAGCTGCAGCCAGG + Intronic
1185328353 22:50238990-50239012 GGACAGGAGCATGTGCCCCCGGG - Intronic
950500195 3:13358852-13358874 GCCCAGGAGGAGCTGCAGCCTGG + Intronic
950848936 3:16043780-16043802 GTCCACGTGCATGTGCACCCTGG + Intergenic
953384498 3:42498971-42498993 CCCCAAAAGAAGGTGCACCCTGG + Intronic
953397495 3:42584676-42584698 TCCCAGGAGGTGGTGAACCCTGG - Intronic
954300909 3:49700309-49700331 GTCCAGGACCTGGTGCACCACGG - Exonic
955494087 3:59512987-59513009 GCTCTGGAGCAGGTGGACCGAGG + Intergenic
956936472 3:74107579-74107601 ACATAGGAGCAGGTACACCCTGG + Intergenic
961381441 3:126498636-126498658 GCCCAGGAGGAGGCACCCCCTGG - Intronic
961976065 3:131026670-131026692 GCCAAGGAGCAGGTGTTCTCGGG + Exonic
962312713 3:134337480-134337502 GCCCATGGGCAGCTCCACCCTGG - Intergenic
962437588 3:135380953-135380975 GCCCAGGAGCTGGGGCTACCTGG - Intergenic
962711098 3:138086742-138086764 GTCCAGGAGCAGGGGCCTCCAGG - Intronic
962870035 3:139480769-139480791 GCCCAGGCCCAGGCCCACCCAGG + Intergenic
963328550 3:143889056-143889078 GCCCAGCAGCAGCAGCACCTGGG + Intergenic
964157406 3:153602749-153602771 GACCAGGTGCAGGAGCAGCCAGG - Intergenic
964768714 3:160202705-160202727 GCCCAGGAGCAGTAGCAGCAGGG - Intergenic
966159964 3:176957491-176957513 GGTCATGAGCAGGTGCATCCTGG - Intergenic
966896429 3:184448532-184448554 GCCAAGCAACAGGAGCACCCAGG + Intronic
967042825 3:185709415-185709437 GCCCAGCAGCAAGTGCCCCTGGG - Intronic
967097386 3:186188143-186188165 GCCCAGTAGTAGGTGCCCTCAGG - Intronic
968545348 4:1195160-1195182 GCCCAGGAGGAGGAGCTGCCTGG - Intronic
968547188 4:1205364-1205386 TCCTCGGAGCAGCTGCACCCAGG + Intronic
968650035 4:1756872-1756894 GGCCAGGACCTGGGGCACCCCGG - Intergenic
968650058 4:1756932-1756954 GGCCAGGACCTGGGGCACCCCGG - Intergenic
968650081 4:1756992-1757014 GGCCAGGACCTGGGGCACCCCGG - Intergenic
968896835 4:3409235-3409257 GGGCAGGAGCAGGAGCACACTGG + Intronic
969443898 4:7233356-7233378 GCCCTGGAGCAGGTGCTCAGCGG - Intronic
970583683 4:17495283-17495305 GCCCGGGAGCAGGCAGACCCTGG - Intronic
971125318 4:23747512-23747534 GCCTTGGAGCAGGTGGCCCCAGG + Intergenic
973373297 4:49270745-49270767 GCCCAGGGGCGGCTGCACCGGGG - Intergenic
978219803 4:106256460-106256482 GCCCAGGTGCTGTTGGACCCCGG - Intronic
982609634 4:157557440-157557462 ACCCAGGAATAGGTGCACCAGGG - Intergenic
983994837 4:174169221-174169243 TCTCAAGAACAGGTGCACCCTGG - Intergenic
984831701 4:183981774-183981796 GCCCAGCCGCAGGTGCACTTTGG - Intronic
985147123 4:186904968-186904990 GCCCTGTAGCGGGTGCAGCCCGG - Intergenic
985528270 5:418832-418854 CCCATGCAGCAGGTGCACCCAGG + Intronic
985655671 5:1130353-1130375 ACGCAGATGCAGGTGCACCCTGG - Intergenic
985661591 5:1159935-1159957 GCCCAGGTGCGGGTGACCCCTGG - Intergenic
985671426 5:1208893-1208915 GCCTCGGAGCAGTTCCACCCGGG + Intronic
985682965 5:1266065-1266087 CCGCAGGCTCAGGTGCACCCTGG + Intronic
986222021 5:5776500-5776522 GCCCAGGAGGATGAGGACCCAGG + Intergenic
986615013 5:9606915-9606937 CCACTGGAGCAGGTGCACCATGG + Intergenic
987268402 5:16279768-16279790 TCACAGGAGCAGGAGCACACGGG + Intergenic
990513800 5:56513856-56513878 GCACAGGGCCAGGAGCACCCGGG - Exonic
990581876 5:57173747-57173769 GCCCCGGAGCAGGGGCGCGCGGG - Intergenic
994851178 5:105057109-105057131 GCCCAGGTGCTGTTGCAGCCAGG + Intergenic
997669719 5:135660831-135660853 GACCAGCAGCAGCAGCACCCGGG - Intergenic
1001679736 5:173547386-173547408 CCTCAGGAGCAGGTGGAACCTGG + Intergenic
1002330766 5:178438989-178439011 TCTCAGGCGCAGGTGCACACTGG - Intronic
1003121781 6:3324060-3324082 GCACTGGCCCAGGTGCACCCAGG - Intronic
1003556157 6:7141806-7141828 GCCCAGGAGAACGGGCAGCCGGG + Intronic
1006073763 6:31516168-31516190 GCCCAGGAGCACCTGCAGGCAGG - Intergenic
1006272421 6:32974500-32974522 GCCCAGAAGCAGCAGCACCAGGG + Exonic
1007093559 6:39199676-39199698 GCCCAGGGGCAGGCAGACCCAGG - Intronic
1007593337 6:43036659-43036681 TCCCAGGAGCAGGGGATCCCAGG - Intergenic
1010210903 6:73362509-73362531 GCCCAGGAACCGGTGCACTTGGG + Intergenic
1011531656 6:88329388-88329410 GCCCAGGATCAAGTCCAGCCTGG + Intergenic
1016999707 6:149987892-149987914 GCCCAGGAGCAAGACCAACCTGG - Intergenic
1017006913 6:150034386-150034408 GCCCAGGAGCAAGGCCAGCCTGG + Intergenic
1018417408 6:163613015-163613037 CACCAGGAGCAGGTGAACACAGG + Intergenic
1018429894 6:163714102-163714124 GCCCAGGAGGAGGTCCCTCCGGG - Intergenic
1019153633 6:170024510-170024532 GCCTGGGATCAGGGGCACCCGGG - Intergenic
1019232916 6:170584145-170584167 GCCCGGGAGAAGGTGCTCCTGGG + Intronic
1019398156 7:834481-834503 GCCCAGGACCAGGAGGACCCAGG - Intronic
1019406634 7:887481-887503 GGCCAGCAGCTGGTGCAGCCGGG - Exonic
1019471603 7:1224234-1224256 GCCCCGAAGCAGCTGCACCCCGG - Intergenic
1021253812 7:18364568-18364590 GACCAGCAGCATGGGCACCCTGG + Intronic
1022514182 7:30964960-30964982 ACTCAGGAGCAGGTGCAGCAAGG - Intronic
1023881706 7:44324864-44324886 GCGCAGGAGCAGGCGCAAGCAGG + Intronic
1024217075 7:47256687-47256709 GCCCAGGCTCAGGTGCCCGCTGG - Intergenic
1026598498 7:71753899-71753921 GCCTGGGGACAGGTGCACCCTGG - Intergenic
1029707240 7:102282467-102282489 GGCCAGGAGCCGCTGGACCCTGG - Intronic
1032716233 7:134511480-134511502 GCACAAGAGCAGGTTCATCCTGG + Intergenic
1033290580 7:140079433-140079455 GGCCAGGAGCAGGTGGACTGAGG + Intergenic
1034432855 7:151049682-151049704 CCCCAGGAGCAGGGCCTCCCTGG - Intronic
1034781941 7:153888499-153888521 GCCCGAGAGCAGGCGCGCCCAGG - Intronic
1034996049 7:155577880-155577902 GCCCGGGAGCAGGTAGAGCCAGG - Intergenic
1034996061 7:155577931-155577953 GCCCGGGAGCAGGTAGAGCCAGG - Intergenic
1035045974 7:155965735-155965757 GCCCAAGACCAGGACCACCCGGG - Exonic
1035310459 7:157964581-157964603 ACACAGGAGCAGGTGCAGCAGGG + Intronic
1035634833 8:1136752-1136774 GCCAGGGAGCAGGAGCACACGGG + Intergenic
1037273763 8:17156622-17156644 GCCCAGGAGCCCGTCCAGCCAGG + Exonic
1037706863 8:21322640-21322662 TCCCAGCAGCAGGGGCTCCCAGG + Intergenic
1037844979 8:22275304-22275326 GCCCTGGAGCATGTGGGCCCCGG + Exonic
1041684762 8:60633229-60633251 CCCCAGGAGAAGGAGCACCAGGG - Intergenic
1043472075 8:80573112-80573134 GCCCAAGGGCAAGTGCATCCTGG - Intergenic
1043486664 8:80704726-80704748 TCCCAGGGGGAGGTGCCCCCAGG + Intronic
1045488714 8:102654447-102654469 GGCCGGGAGCGGGTGCGCCCGGG - Intronic
1047330167 8:123879835-123879857 GCCCAGCAACATGTGCTCCCTGG - Intronic
1049148530 8:141019639-141019661 TTCCAGGAGCAGGAGCAGCCTGG - Intergenic
1049150334 8:141030985-141031007 GAACAGGAGCAGGTGCAGTCAGG + Intergenic
1049245451 8:141560004-141560026 TCCCAGGAGCAGGTGCTGGCAGG + Intergenic
1049278429 8:141731632-141731654 GCCCAGGAGCAGGACCAGGCTGG - Intergenic
1049549799 8:143251934-143251956 GGCCAGCAGCAGGAGCAGCCGGG - Intronic
1049591481 8:143464872-143464894 GGCCAGGTGCAGGAGCCCCCAGG + Intronic
1049896052 9:113254-113276 GCCCAGGAACAGGTGCACCAGGG - Intergenic
1052437043 9:28443441-28443463 GCCATGGGGCAGCTGCACCCAGG - Intronic
1052818921 9:33123788-33123810 GCCCATGAGCAATGGCACCCTGG + Intronic
1052840730 9:33289438-33289460 CCCCAGGAGGTGGTGCCCCCTGG + Intergenic
1053696166 9:40641358-40641380 CACCAGGGGCAGGTGCATCCTGG + Intergenic
1054307413 9:63440577-63440599 CACCAGGGGCAGGTGCATCCTGG + Intergenic
1054406145 9:64764588-64764610 CACCAGGGGCAGGTGCATCCTGG + Intergenic
1054439771 9:65250061-65250083 CACCAGGGGCAGGTGCATCCTGG + Intergenic
1054490636 9:65771878-65771900 CACCAGGGGCAGGTGCATCCTGG - Intergenic
1054786614 9:69216434-69216456 GCCCATCAGCAGGCCCACCCGGG - Exonic
1055336282 9:75236405-75236427 GCCAGGGGGCAGGTGCACCATGG + Intergenic
1055532039 9:77194205-77194227 GCCCATGTGCAGGTGCTCTCTGG + Intronic
1057233546 9:93340283-93340305 GCACAGGAGCAGATACACACAGG + Intronic
1057846997 9:98533450-98533472 TCCCAGGAACAGGTGGACTCAGG + Intronic
1058667034 9:107328686-107328708 GCCCAGGAGCAGGTGAGCAGTGG - Intronic
1060791591 9:126489098-126489120 GCCCAGGAGCGCATGCTCCCTGG - Intronic
1061042036 9:128145938-128145960 GCCCAAGAGTGGGTGCTCCCTGG - Intergenic
1061180763 9:129023801-129023823 GGCCAGGAGCAGCTGGCCCCAGG - Intronic
1061306374 9:129735497-129735519 GCCCAGGAGCTGGAGGACCCAGG - Intergenic
1061519289 9:131108121-131108143 GCCCAGGTGCAGGAGGACACAGG + Intronic
1061678675 9:132231971-132231993 GCTCAGGAACAGGTTGACCCAGG - Intronic
1061904605 9:133690333-133690355 TCCAGGCAGCAGGTGCACCCAGG + Intronic
1062056316 9:134471218-134471240 GCCCAGGCTCAGGAGGACCCAGG - Intergenic
1062056426 9:134471609-134471631 TCCCAGGATCAGGAGGACCCAGG - Intergenic
1062141447 9:134961285-134961307 GGCCAAGAGCAGCTGCAACCAGG + Intergenic
1062483848 9:136764564-136764586 GCCCAGGAGCAGGTGCACCCAGG - Intronic
1062533646 9:137012274-137012296 GCCCAAGAGCAAGGGCAACCCGG - Exonic
1062550864 9:137086017-137086039 GCCCAAGGGCAGGAGCAGCCTGG + Intergenic
1202778615 9_KI270717v1_random:15019-15041 CACCAGGGGCAGGTGCATCCTGG + Intergenic
1203523614 Un_GL000213v1:67244-67266 GCCCAGGAGCTGGAGCCCTCCGG + Intergenic
1203739030 Un_GL000216v2:162414-162436 GCACTGCAGCAGGTGCAGCCAGG + Intergenic
1203552203 Un_KI270743v1:172281-172303 GCCCAGGGGCGGCTGCACCGGGG + Intergenic
1203585688 Un_KI270747v1:1430-1452 CACCAGGGGCAGGTGCATCCTGG + Intergenic
1185455933 X:310959-310981 GACGTGGAGCAGGTGCACCCGGG + Intronic
1185627729 X:1494179-1494201 GCCCAGGAGGAGGGTCCCCCAGG - Intronic
1186529616 X:10282115-10282137 GCCCAGGAGCTGGGGCAGCCTGG - Intergenic
1187268040 X:17755387-17755409 GGCCAAGAGCAGGTGCATCCAGG - Intergenic
1187321210 X:18238896-18238918 GGCCAAGAGCAGGTGCATCCAGG + Intergenic
1189695497 X:43657465-43657487 AGCCAGGACCAGGGGCACCCTGG - Intronic
1190681589 X:52830995-52831017 GGGCAGCTGCAGGTGCACCCAGG - Intergenic
1195577455 X:106467637-106467659 ACCCGGGAGCAGGAGGACCCAGG - Intergenic
1199264814 X:145817909-145817931 GCCCAGGAGCGAGAGCACCGCGG - Intronic
1200088838 X:153625027-153625049 GCCTGGGCCCAGGTGCACCCTGG + Intergenic
1200114607 X:153764691-153764713 GCACAGGAGCAGGTGCACTGGGG - Intronic
1200138693 X:153886744-153886766 GCGCAGGAGCCGGTGCTCCGCGG - Intronic
1201177956 Y:11321452-11321474 GCGCTGCAGCAGGTGCAGCCAGG - Intergenic
1201179523 Y:11332225-11332247 GCACTGCGGCAGGTGCACCCAGG - Intergenic
1201986242 Y:19970692-19970714 GCTCTGGATCAGGTGGACCCAGG + Intergenic