ID: 1062484926

View in Genome Browser
Species Human (GRCh38)
Location 9:136769981-136770003
Sequence CAGGGCAAAGAGAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062484926_1062484934 10 Left 1062484926 9:136769981-136770003 CCTTCCTCTCTCTCTTTGCCCTG No data
Right 1062484934 9:136770014-136770036 CTGCCCTGCACGACAACACCAGG No data
1062484926_1062484935 11 Left 1062484926 9:136769981-136770003 CCTTCCTCTCTCTCTTTGCCCTG No data
Right 1062484935 9:136770015-136770037 TGCCCTGCACGACAACACCAGGG No data
1062484926_1062484936 12 Left 1062484926 9:136769981-136770003 CCTTCCTCTCTCTCTTTGCCCTG No data
Right 1062484936 9:136770016-136770038 GCCCTGCACGACAACACCAGGGG No data
1062484926_1062484938 13 Left 1062484926 9:136769981-136770003 CCTTCCTCTCTCTCTTTGCCCTG No data
Right 1062484938 9:136770017-136770039 CCCTGCACGACAACACCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062484926 Original CRISPR CAGGGCAAAGAGAGAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr