ID: 1062485235

View in Genome Browser
Species Human (GRCh38)
Location 9:136771206-136771228
Sequence GGGCGTCCAACAGGACTTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062485230_1062485235 4 Left 1062485230 9:136771179-136771201 CCAAGAATGAGAGAATGGGAAGG No data
Right 1062485235 9:136771206-136771228 GGGCGTCCAACAGGACTTTCCGG No data
1062485229_1062485235 5 Left 1062485229 9:136771178-136771200 CCCAAGAATGAGAGAATGGGAAG No data
Right 1062485235 9:136771206-136771228 GGGCGTCCAACAGGACTTTCCGG No data
1062485228_1062485235 6 Left 1062485228 9:136771177-136771199 CCCCAAGAATGAGAGAATGGGAA No data
Right 1062485235 9:136771206-136771228 GGGCGTCCAACAGGACTTTCCGG No data
1062485224_1062485235 30 Left 1062485224 9:136771153-136771175 CCTCTCTTAGCGTCTGGATCAGG No data
Right 1062485235 9:136771206-136771228 GGGCGTCCAACAGGACTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062485235 Original CRISPR GGGCGTCCAACAGGACTTTC CGG Intergenic
No off target data available for this crispr