ID: 1062487587

View in Genome Browser
Species Human (GRCh38)
Location 9:136787695-136787717
Sequence TCTTGGGCCCCTCTTCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062487579_1062487587 10 Left 1062487579 9:136787662-136787684 CCATTTCTGGCATCAGCTCGGGG No data
Right 1062487587 9:136787695-136787717 TCTTGGGCCCCTCTTCCAGGTGG No data
1062487577_1062487587 11 Left 1062487577 9:136787661-136787683 CCCATTTCTGGCATCAGCTCGGG No data
Right 1062487587 9:136787695-136787717 TCTTGGGCCCCTCTTCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062487587 Original CRISPR TCTTGGGCCCCTCTTCCAGG TGG Intergenic
No off target data available for this crispr