ID: 1062490779

View in Genome Browser
Species Human (GRCh38)
Location 9:136803888-136803910
Sequence CTTTCCTCCACCTCCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062490779_1062490786 23 Left 1062490779 9:136803888-136803910 CCCTGGGAGGAGGTGGAGGAAAG No data
Right 1062490786 9:136803934-136803956 AAAGGGTGTACTCAGGCTGCAGG No data
1062490779_1062490788 29 Left 1062490779 9:136803888-136803910 CCCTGGGAGGAGGTGGAGGAAAG No data
Right 1062490788 9:136803940-136803962 TGTACTCAGGCTGCAGGGACTGG No data
1062490779_1062490785 16 Left 1062490779 9:136803888-136803910 CCCTGGGAGGAGGTGGAGGAAAG No data
Right 1062490785 9:136803927-136803949 GCTTCAGAAAGGGTGTACTCAGG No data
1062490779_1062490782 5 Left 1062490779 9:136803888-136803910 CCCTGGGAGGAGGTGGAGGAAAG No data
Right 1062490782 9:136803916-136803938 ACCAGGTCTGTGCTTCAGAAAGG No data
1062490779_1062490784 6 Left 1062490779 9:136803888-136803910 CCCTGGGAGGAGGTGGAGGAAAG No data
Right 1062490784 9:136803917-136803939 CCAGGTCTGTGCTTCAGAAAGGG No data
1062490779_1062490787 24 Left 1062490779 9:136803888-136803910 CCCTGGGAGGAGGTGGAGGAAAG No data
Right 1062490787 9:136803935-136803957 AAGGGTGTACTCAGGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062490779 Original CRISPR CTTTCCTCCACCTCCTCCCA GGG (reversed) Intronic