ID: 1062490835

View in Genome Browser
Species Human (GRCh38)
Location 9:136804165-136804187
Sequence GAGGCCAGGTTTTGGGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062490829_1062490835 -5 Left 1062490829 9:136804147-136804169 CCCAAGGGCACGCTGGAAGAGGC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1062490835 9:136804165-136804187 GAGGCCAGGTTTTGGGGAAGAGG No data
1062490830_1062490835 -6 Left 1062490830 9:136804148-136804170 CCAAGGGCACGCTGGAAGAGGCC 0: 1
1: 0
2: 1
3: 16
4: 197
Right 1062490835 9:136804165-136804187 GAGGCCAGGTTTTGGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062490835 Original CRISPR GAGGCCAGGTTTTGGGGAAG AGG Intronic
No off target data available for this crispr