ID: 1062494429

View in Genome Browser
Species Human (GRCh38)
Location 9:136825117-136825139
Sequence ACCATCGCAGCTGGGCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062494429_1062494437 -1 Left 1062494429 9:136825117-136825139 CCAGCAGGCCCAGCTGCGATGGT No data
Right 1062494437 9:136825139-136825161 TGCGGTGTGAGGCAGGCCTGGGG No data
1062494429_1062494434 -8 Left 1062494429 9:136825117-136825139 CCAGCAGGCCCAGCTGCGATGGT No data
Right 1062494434 9:136825132-136825154 GCGATGGTGCGGTGTGAGGCAGG No data
1062494429_1062494445 25 Left 1062494429 9:136825117-136825139 CCAGCAGGCCCAGCTGCGATGGT No data
Right 1062494445 9:136825165-136825187 CTCAGGTGGCTCCGAAGGGAGGG No data
1062494429_1062494439 11 Left 1062494429 9:136825117-136825139 CCAGCAGGCCCAGCTGCGATGGT No data
Right 1062494439 9:136825151-136825173 CAGGCCTGGGGCCTCTCAGGTGG No data
1062494429_1062494446 30 Left 1062494429 9:136825117-136825139 CCAGCAGGCCCAGCTGCGATGGT No data
Right 1062494446 9:136825170-136825192 GTGGCTCCGAAGGGAGGGTCCGG No data
1062494429_1062494444 24 Left 1062494429 9:136825117-136825139 CCAGCAGGCCCAGCTGCGATGGT No data
Right 1062494444 9:136825164-136825186 TCTCAGGTGGCTCCGAAGGGAGG No data
1062494429_1062494441 20 Left 1062494429 9:136825117-136825139 CCAGCAGGCCCAGCTGCGATGGT No data
Right 1062494441 9:136825160-136825182 GGCCTCTCAGGTGGCTCCGAAGG No data
1062494429_1062494435 -3 Left 1062494429 9:136825117-136825139 CCAGCAGGCCCAGCTGCGATGGT No data
Right 1062494435 9:136825137-136825159 GGTGCGGTGTGAGGCAGGCCTGG No data
1062494429_1062494436 -2 Left 1062494429 9:136825117-136825139 CCAGCAGGCCCAGCTGCGATGGT No data
Right 1062494436 9:136825138-136825160 GTGCGGTGTGAGGCAGGCCTGGG No data
1062494429_1062494442 21 Left 1062494429 9:136825117-136825139 CCAGCAGGCCCAGCTGCGATGGT No data
Right 1062494442 9:136825161-136825183 GCCTCTCAGGTGGCTCCGAAGGG No data
1062494429_1062494438 8 Left 1062494429 9:136825117-136825139 CCAGCAGGCCCAGCTGCGATGGT No data
Right 1062494438 9:136825148-136825170 AGGCAGGCCTGGGGCCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062494429 Original CRISPR ACCATCGCAGCTGGGCCTGC TGG (reversed) Intronic