ID: 1062494434

View in Genome Browser
Species Human (GRCh38)
Location 9:136825132-136825154
Sequence GCGATGGTGCGGTGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062494429_1062494434 -8 Left 1062494429 9:136825117-136825139 CCAGCAGGCCCAGCTGCGATGGT No data
Right 1062494434 9:136825132-136825154 GCGATGGTGCGGTGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062494434 Original CRISPR GCGATGGTGCGGTGTGAGGC AGG Intronic