ID: 1062494446

View in Genome Browser
Species Human (GRCh38)
Location 9:136825170-136825192
Sequence GTGGCTCCGAAGGGAGGGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062494432_1062494446 21 Left 1062494432 9:136825126-136825148 CCAGCTGCGATGGTGCGGTGTGA No data
Right 1062494446 9:136825170-136825192 GTGGCTCCGAAGGGAGGGTCCGG No data
1062494440_1062494446 -8 Left 1062494440 9:136825155-136825177 CCTGGGGCCTCTCAGGTGGCTCC No data
Right 1062494446 9:136825170-136825192 GTGGCTCCGAAGGGAGGGTCCGG No data
1062494431_1062494446 22 Left 1062494431 9:136825125-136825147 CCCAGCTGCGATGGTGCGGTGTG No data
Right 1062494446 9:136825170-136825192 GTGGCTCCGAAGGGAGGGTCCGG No data
1062494429_1062494446 30 Left 1062494429 9:136825117-136825139 CCAGCAGGCCCAGCTGCGATGGT No data
Right 1062494446 9:136825170-136825192 GTGGCTCCGAAGGGAGGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062494446 Original CRISPR GTGGCTCCGAAGGGAGGGTC CGG Intronic