ID: 1062494881

View in Genome Browser
Species Human (GRCh38)
Location 9:136827000-136827022
Sequence GGCACAGCAGGCCACCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 337}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062494881_1062494892 1 Left 1062494881 9:136827000-136827022 CCTTCCTGGTGGCCTGCTGTGCC 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1062494892 9:136827024-136827046 GGGGCTGGTGTGGAGGCCTGTGG 0: 1
1: 0
2: 12
3: 127
4: 856
1062494881_1062494893 2 Left 1062494881 9:136827000-136827022 CCTTCCTGGTGGCCTGCTGTGCC 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG 0: 1
1: 0
2: 6
3: 55
4: 392
1062494881_1062494888 -9 Left 1062494881 9:136827000-136827022 CCTTCCTGGTGGCCTGCTGTGCC 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1062494888 9:136827014-136827036 TGCTGTGCCCGGGGCTGGTGTGG 0: 1
1: 0
2: 3
3: 40
4: 448
1062494881_1062494889 -6 Left 1062494881 9:136827000-136827022 CCTTCCTGGTGGCCTGCTGTGCC 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1062494889 9:136827017-136827039 TGTGCCCGGGGCTGGTGTGGAGG 0: 1
1: 0
2: 3
3: 63
4: 563
1062494881_1062494894 10 Left 1062494881 9:136827000-136827022 CCTTCCTGGTGGCCTGCTGTGCC 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1062494894 9:136827033-136827055 GTGGAGGCCTGTGGGTGCAGAGG 0: 1
1: 0
2: 3
3: 55
4: 521
1062494881_1062494896 18 Left 1062494881 9:136827000-136827022 CCTTCCTGGTGGCCTGCTGTGCC 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1062494896 9:136827041-136827063 CTGTGGGTGCAGAGGCCGCCTGG 0: 1
1: 0
2: 3
3: 52
4: 408
1062494881_1062494898 25 Left 1062494881 9:136827000-136827022 CCTTCCTGGTGGCCTGCTGTGCC 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1062494898 9:136827048-136827070 TGCAGAGGCCGCCTGGCCCTGGG 0: 1
1: 0
2: 1
3: 36
4: 319
1062494881_1062494897 24 Left 1062494881 9:136827000-136827022 CCTTCCTGGTGGCCTGCTGTGCC 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1062494897 9:136827047-136827069 GTGCAGAGGCCGCCTGGCCCTGG 0: 1
1: 0
2: 0
3: 32
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062494881 Original CRISPR GGCACAGCAGGCCACCAGGA AGG (reversed) Intronic