ID: 1062494893

View in Genome Browser
Species Human (GRCh38)
Location 9:136827025-136827047
Sequence GGGCTGGTGTGGAGGCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 392}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062494887_1062494893 -10 Left 1062494887 9:136827012-136827034 CCTGCTGTGCCCGGGGCTGGTGT 0: 1
1: 0
2: 1
3: 39
4: 307
Right 1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG 0: 1
1: 0
2: 6
3: 55
4: 392
1062494880_1062494893 3 Left 1062494880 9:136826999-136827021 CCCTTCCTGGTGGCCTGCTGTGC 0: 1
1: 0
2: 2
3: 43
4: 292
Right 1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG 0: 1
1: 0
2: 6
3: 55
4: 392
1062494878_1062494893 5 Left 1062494878 9:136826997-136827019 CCCCCTTCCTGGTGGCCTGCTGT 0: 1
1: 1
2: 3
3: 43
4: 373
Right 1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG 0: 1
1: 0
2: 6
3: 55
4: 392
1062494879_1062494893 4 Left 1062494879 9:136826998-136827020 CCCCTTCCTGGTGGCCTGCTGTG 0: 1
1: 1
2: 13
3: 39
4: 333
Right 1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG 0: 1
1: 0
2: 6
3: 55
4: 392
1062494873_1062494893 24 Left 1062494873 9:136826978-136827000 CCACGGCTTAGGATGGGCCCCCC 0: 1
1: 0
2: 1
3: 5
4: 67
Right 1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG 0: 1
1: 0
2: 6
3: 55
4: 392
1062494883_1062494893 -2 Left 1062494883 9:136827004-136827026 CCTGGTGGCCTGCTGTGCCCGGG 0: 1
1: 0
2: 1
3: 25
4: 320
Right 1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG 0: 1
1: 0
2: 6
3: 55
4: 392
1062494877_1062494893 6 Left 1062494877 9:136826996-136827018 CCCCCCTTCCTGGTGGCCTGCTG 0: 1
1: 1
2: 1
3: 38
4: 357
Right 1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG 0: 1
1: 0
2: 6
3: 55
4: 392
1062494881_1062494893 2 Left 1062494881 9:136827000-136827022 CCTTCCTGGTGGCCTGCTGTGCC 0: 1
1: 0
2: 5
3: 27
4: 337
Right 1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG 0: 1
1: 0
2: 6
3: 55
4: 392
1062494876_1062494893 7 Left 1062494876 9:136826995-136827017 CCCCCCCTTCCTGGTGGCCTGCT 0: 1
1: 0
2: 4
3: 60
4: 421
Right 1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG 0: 1
1: 0
2: 6
3: 55
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062494893 Original CRISPR GGGCTGGTGTGGAGGCCTGT GGG Intronic
900082569 1:869754-869776 GGGGAGGTGTGGGGGCCTGGGGG - Intergenic
900114443 1:1022475-1022497 GGGCTCGTGTGGGGGCCTGTGGG + Intronic
900291605 1:1926075-1926097 CGGCTGGTGTGAGGGCCTGGGGG + Intronic
900388260 1:2420369-2420391 AGGTGGGTGTGGGGGCCTGTGGG + Intergenic
900927731 1:5716649-5716671 GGGCTGGTCAGGAGGCAAGTGGG + Intergenic
900956268 1:5888030-5888052 TGGCTGGGGTAGAGGCCCGTGGG + Intronic
901158179 1:7154699-7154721 GGGCTGGTGTGGGGGACAGGAGG - Intronic
901672834 1:10866331-10866353 GGGCTGGTGGGGGGGCAGGTGGG - Intergenic
901823551 1:11846125-11846147 AGGCTGGGGTGGGGGCCGGTGGG - Intronic
902160109 1:14523161-14523183 GGGTTGGTGAGGATGCCAGTGGG - Intergenic
902202457 1:14844151-14844173 GGGCTGGAGTGGGGTGCTGTGGG - Intronic
902233307 1:15042084-15042106 GGCCGGGTGGGAAGGCCTGTAGG - Intronic
902311927 1:15587550-15587572 GGGCTGGGGTGGAGCACTGCAGG - Intronic
902389528 1:16094978-16095000 GGGGTGGGGTGGAGGCGAGTGGG + Intergenic
902552104 1:17225255-17225277 GGTCTGGTGGGGAGGTGTGTTGG + Intronic
902554787 1:17240540-17240562 GGGCCCGTGTGGAGCCCTCTGGG - Intronic
902664796 1:17929971-17929993 GGGGTGGTGTGGATGGCAGTAGG + Intergenic
903263192 1:22142357-22142379 GGGCTGGGCTGGAGGCGTGCAGG - Intronic
903929672 1:26855084-26855106 GGGCTGGTGGGTAGGGCTGGGGG - Exonic
904470366 1:30732181-30732203 GGGCGTGTGTGGAGGGGTGTGGG + Intergenic
906249992 1:44303656-44303678 TGGCTGGTGGGGAGGGGTGTGGG + Intronic
906513102 1:46422804-46422826 GGGCTGGTCTGGAGGCCCCAGGG + Intergenic
907010029 1:50954204-50954226 GGCCTGGCGTGGTGGCCTTTGGG - Intronic
907362261 1:53927535-53927557 GGGTTGTGGTGGAGGTCTGTGGG + Intronic
911702561 1:100971130-100971152 GGGCTTGTGAGGAGGCTTTTTGG - Intronic
912429444 1:109621241-109621263 GAGCTGCAGTGGAGGCCTGCAGG - Exonic
914240727 1:145850924-145850946 GGGCTGTACTGGAGGCCTGTGGG + Exonic
914883520 1:151566199-151566221 GGGCTGCTGTACAGGGCTGTGGG - Exonic
915267519 1:154729476-154729498 GGACTGGTGTGGAGGAGTCTCGG - Intronic
915940598 1:160116106-160116128 GGGCATGTGTGGTGGGCTGTGGG - Intronic
916242312 1:162652367-162652389 GGCCTGGTGGGGAGGAATGTAGG + Intronic
916264992 1:162881897-162881919 AGGCTGATGTGGAGGCCACTGGG - Intergenic
916451151 1:164921653-164921675 TGGCTCCTGTGGAGGCCTGCAGG - Intergenic
917045421 1:170854451-170854473 GGGCTGGTGTGTGGGCATGCTGG - Intergenic
919925319 1:202189006-202189028 GGGCTGGGGTGGGGGCGTGGGGG + Intergenic
920854480 1:209651839-209651861 TGGCTGGGGTGGAGGGCTGGGGG + Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921363191 1:214349331-214349353 GGGCTGTGGTGGAGGTCAGTGGG + Exonic
922028261 1:221773691-221773713 GGAAGGGTGGGGAGGCCTGTAGG + Intergenic
922674647 1:227542853-227542875 GGGGAAGTGTGGAGGCCTGCGGG + Intergenic
923051495 1:230393925-230393947 GGGCAGGTGTGGCGGACTCTAGG - Intronic
1062799542 10:368958-368980 GGGCTGGTGGGGAGGCACGGCGG + Intronic
1063623359 10:7667623-7667645 GGGCTGGTGTGGGGGCCACAGGG - Intergenic
1064227749 10:13502711-13502733 GGCCTGATGGGGAGGGCTGTGGG - Intronic
1064503016 10:15995136-15995158 GGACTGGTGTGGAACACTGTTGG - Intergenic
1064997950 10:21313039-21313061 GGGTAAGTGTGAAGGCCTGTGGG - Intergenic
1067298998 10:44992640-44992662 GGGCTGGTGGGGAGGCAGCTAGG + Intronic
1067722917 10:48743243-48743265 GGGCTGTTTTGGAGCCCTGGAGG + Exonic
1067804103 10:49381466-49381488 GGGTTGGTGCTGGGGCCTGTGGG - Intronic
1067832139 10:49616409-49616431 GGGCTGGGGTGGGGGTCTGTTGG + Intronic
1067907360 10:50307398-50307420 GGGCAGGTATGGAGTCCTTTGGG - Intronic
1070289784 10:75106620-75106642 GGGCCAGTGTGGAGGGCTCTGGG - Intronic
1070728367 10:78807907-78807929 GGGCTGGGGTGAAGGCTTGGTGG + Intergenic
1070808686 10:79286357-79286379 GGGCTGCTGTGGGGGCCTGCGGG + Intronic
1070880271 10:79848594-79848616 GGGCTGGGGTGGTGGCCGGCGGG - Exonic
1072426493 10:95334884-95334906 CCGCTGCTGTGGAGGGCTGTAGG - Intronic
1072721211 10:97782072-97782094 GGGCTGGTGGGGGGCCCAGTGGG + Intergenic
1073173389 10:101532889-101532911 GGGGTGCTGTGGAGACTTGTTGG - Intronic
1074971736 10:118544648-118544670 ATGCTGCTGTGGAGGTCTGTTGG - Intergenic
1075092427 10:119451122-119451144 GGGCTGGCATGGATGACTGTGGG - Intronic
1076214019 10:128678577-128678599 GGGCTTGTGTGGAGGCAGCTAGG + Intergenic
1076304386 10:129454077-129454099 GGGCTGCTATGAAGGCCGGTGGG + Intergenic
1076721574 10:132395635-132395657 GGGCAGCTGCAGAGGCCTGTGGG + Intergenic
1076776109 10:132699200-132699222 GGGCTGTGGTGCAGGCCCGTCGG + Intronic
1076814304 10:132907086-132907108 GTCCTGGTGTGCAGGGCTGTGGG + Intronic
1076852509 10:133099976-133099998 AGGCAGGTGTGGGAGCCTGTGGG - Intronic
1077474042 11:2778127-2778149 GGGAAGGTGGGGAGGCCTGCAGG - Intronic
1079240383 11:18718273-18718295 GGGCCTGTGAGGAGGCCTGTGGG - Intronic
1079403120 11:20122308-20122330 GGCATGGTTTGGAGTCCTGTGGG + Intergenic
1080552369 11:33383675-33383697 GGGCAGGTGTGGTGGCAGGTGGG + Intergenic
1081575915 11:44318410-44318432 GTGATAGTGGGGAGGCCTGTGGG + Intergenic
1082785771 11:57315648-57315670 GGGGAGGTGTGGAGGTCTGACGG - Intronic
1083406302 11:62459576-62459598 GGGCTTGTGTGGAGGTGTGGAGG - Intronic
1083619668 11:64042584-64042606 GGCCTGGTGGCCAGGCCTGTGGG + Intronic
1083815178 11:65128584-65128606 GGGCTGGTGGGGAGGCTCCTGGG + Exonic
1083962269 11:66021054-66021076 GGGCTGGGGTGGGGGCCTGAGGG - Intronic
1084271858 11:68033297-68033319 GGGCTGGCGTGGTGGCCGGTTGG - Intronic
1084285609 11:68128649-68128671 GGGCGGGGGTGGGGGCTTGTAGG - Intergenic
1084516631 11:69641275-69641297 GGGCAGCTGGGGAGGGCTGTGGG - Exonic
1084661053 11:70546648-70546670 GGGCTGGTGTAGACCCCTGGTGG + Intronic
1084715205 11:70869315-70869337 CTGCTGGTCTGGAGGCCTCTAGG - Intronic
1084891673 11:72239887-72239909 GGGCCGGTGTGGCGGGCGGTGGG - Exonic
1084957642 11:72699735-72699757 GGGCTGCTGCAGAGGCCTGGGGG - Intronic
1085724328 11:78941389-78941411 GGGCTGGTGGGTGGGCCTATAGG + Intronic
1087756971 11:102064511-102064533 GGGCTCATGTGGAGGCATGAAGG - Intronic
1088283732 11:108164454-108164476 TGGCTGATGTGGTGGCTTGTGGG + Intronic
1089298624 11:117484404-117484426 AGGCTGGTGCGGGGGCCTGGAGG - Intronic
1089312992 11:117572372-117572394 TGGCTGGTGAGGAAGCCTGGAGG + Intronic
1089383675 11:118053773-118053795 GGGCTGGGGTGGGGGTCTTTGGG - Intergenic
1090206568 11:124887559-124887581 GGGCTGGTGGGCAGGCCGGCAGG - Intronic
1090888149 11:130897620-130897642 GGATTGGTGTGGAGTCCTGATGG - Intronic
1091769231 12:3140586-3140608 GGGGTGGTGAGGAGGCGTTTGGG + Intronic
1092154587 12:6274055-6274077 GGGCTGGTGGGGAGGGGTGTGGG + Intergenic
1092183875 12:6464362-6464384 GGGCTGGAATGGAGGACGGTGGG + Exonic
1096152977 12:49326003-49326025 GGGTTGGTGGTGAGGCCTGAGGG + Intronic
1097516950 12:60618014-60618036 AGGCTGTTGTGGTGGCCAGTGGG - Intergenic
1098166702 12:67705869-67705891 GGGCAGGTGTGGAGGCAGGCTGG + Intergenic
1100978029 12:100142544-100142566 GGGCTGGGGTGGAGGCCGACTGG + Intronic
1101858321 12:108462742-108462764 AGGATGGTGTGGAGGCCTTTGGG - Intergenic
1101909531 12:108850829-108850851 GAGCTGGTGGGGAGGGCAGTTGG + Intronic
1102651197 12:114443812-114443834 GGGCTAGAGTGGAGGCCACTGGG + Intergenic
1103060984 12:117858450-117858472 GGGGTGGGGTGGGGGCCTGGAGG + Intronic
1104790679 12:131480327-131480349 GGGCTGGTGTGCAGGACAGCAGG + Intergenic
1106585598 13:31053939-31053961 GGGGTGTGGTGGAGGCGTGTGGG - Intergenic
1106833905 13:33613641-33613663 GGGCTGGTCTGGAGGCTTGCAGG + Intergenic
1107880337 13:44827025-44827047 GGGCTGGTGTGGAAGGGTGGGGG - Intergenic
1108437134 13:50411570-50411592 TGGCTGGTGTGAGGGGCTGTGGG + Intronic
1112180927 13:97079372-97079394 GGGCTGGAGTTGGGGCCTGGTGG - Intergenic
1113955864 13:114099659-114099681 GGGCTGCTGTGGGGGGCTGTGGG - Intronic
1113955895 13:114099729-114099751 GGGCTGCTGTGGGGGGCTGTGGG - Intronic
1113955906 13:114099753-114099775 GGGCTGCTGTGGGGGGCTGTGGG - Intronic
1113955917 13:114099777-114099799 GGGCTGCTGTGGGGGGCTGTGGG - Intronic
1113955928 13:114099801-114099823 GGGCTGCTGTGGGGGGCTGTGGG - Intronic
1113955951 13:114099850-114099872 GGGCTGCTGTGGGGGGCTGTGGG - Intronic
1113955962 13:114099874-114099896 GGGCTGCTGTGGGGGGCTGTGGG - Intronic
1116015822 14:39405496-39405518 GGGGGGGTGTGGAGGCATGGTGG + Intronic
1117048593 14:51838026-51838048 GGGCTTGTGTGTAGACCTGAGGG - Intronic
1117793159 14:59362173-59362195 GGCCTGGGGTGGAGGCTTCTGGG + Intronic
1118773958 14:68961908-68961930 GGGTGGGTGTGAATGCCTGTCGG - Intronic
1119105606 14:71920436-71920458 GAGCTGGTGAGGAGGGCTGATGG + Intergenic
1119404457 14:74388913-74388935 GGGCTGGGGAGGAGCCCTGTGGG - Intergenic
1119481457 14:74960803-74960825 GGCCTGGGGTGGGGCCCTGTTGG + Intergenic
1119484716 14:74980009-74980031 TGTCTGGCGTGAAGGCCTGTGGG - Intergenic
1121340815 14:93104003-93104025 GGGCAGGTGAGGTGGCCTCTTGG + Intronic
1121358152 14:93232058-93232080 GGGCTGCTGCGGGGTCCTGTGGG - Intergenic
1122289708 14:100673866-100673888 AGGTTGGGGTGGAGGCCTGGAGG - Intergenic
1122295513 14:100703559-100703581 GGGCTGCTGTTGAGGCCAGACGG + Intergenic
1122652234 14:103232198-103232220 GGGCTGGGGAGGAGGCCTCTGGG + Intergenic
1122750995 14:103932961-103932983 GAGATGGTGTGGGCGCCTGTGGG + Intronic
1122783304 14:104152838-104152860 GGGCCTGTGTGGAGGCCTGGGGG + Intronic
1122886059 14:104710930-104710952 CGGCTGGTGAGCAGGCCTGCAGG - Exonic
1122956439 14:105073654-105073676 GGGCTGCAGTGGGGGCCTGGGGG + Intergenic
1123030337 14:105448495-105448517 GGGCTGGTGTGTGGGCCTCTGGG + Intronic
1123039151 14:105483321-105483343 GGGCTGGAGGTGAGGCCTGGAGG + Intergenic
1123054434 14:105562354-105562376 CGGCTGGTGTGGGAGCCTGGGGG + Intergenic
1123064834 14:105612551-105612573 AGGCTGGTGTGGTGGGCTGATGG - Intergenic
1123079018 14:105682773-105682795 CGGCTGGTGTGGGAGCCTGGGGG + Intergenic
1123088141 14:105727769-105727791 AGGCTGGTGTGGTGGGCTGATGG - Intergenic
1123094094 14:105757142-105757164 AGGCTGGTGTGGTGGGCTGATGG - Intergenic
1123108016 14:105852048-105852070 GGGGTGGTGTGGGGGCCTCCGGG + Intergenic
1123632587 15:22272500-22272522 GGGATGCGGTGGAGGCATGTCGG + Intergenic
1123735655 15:23180218-23180240 GGGCAGGGGAGGAGGCCTGGCGG + Intergenic
1124003746 15:25780164-25780186 GGGCTGGTGCCGAGGCCGATGGG + Intronic
1124185767 15:27527345-27527367 GTGCTGGGGTGGAGGGATGTGGG + Intronic
1124509029 15:30306588-30306610 GGGCTGGTGTTGAGGGCCTTTGG + Intergenic
1124734528 15:32232074-32232096 GGGCTGGTGTTGAGGGCCTTTGG - Intergenic
1127668923 15:61175606-61175628 GGGCTGATGTGGGGGCGTGGGGG + Intronic
1127808644 15:62543964-62543986 GGGCTGGCGTGGAGGGTAGTAGG + Intronic
1128935440 15:71742431-71742453 GGGCTAGTGTAGAGGTCAGTGGG - Intronic
1129329654 15:74820547-74820569 GGGCTCGTGGGGAAGCCTGTGGG + Intronic
1129470361 15:75750370-75750392 GTGCTGCTGTGGGAGCCTGTAGG + Intergenic
1132349846 15:101132921-101132943 AGTGTGGAGTGGAGGCCTGTGGG - Intergenic
1132500306 16:281964-281986 GGGCTGGTGAGGAGCCTGGTGGG + Intronic
1132551534 16:555739-555761 GGGCTGCTGCGGAGGCCTGGAGG + Intergenic
1133013579 16:2928761-2928783 GGGCTGGGGTGGGGGCCTGGGGG - Intronic
1133240575 16:4411988-4412010 GGGCTGGGGAGGATGCCTGGTGG + Intronic
1134193749 16:12142428-12142450 GGGCTGGTGTTGGGGGCTGGGGG + Intronic
1134502410 16:14779611-14779633 GGGCTGGTGTGGAAGCCAGAGGG + Intronic
1134578154 16:15349283-15349305 GGGCTGGTGTGGAAGCCAGAGGG - Intergenic
1134724437 16:16408263-16408285 GGGCTGGTGTGGAAGCCAGAGGG + Intergenic
1134942994 16:18303596-18303618 GGGCTGGTGTGGAAGCCAGAGGG - Intergenic
1136069151 16:27777787-27777809 GGGCTGGTGGGGAGGCCATGGGG - Intronic
1136253693 16:29024332-29024354 GGGCTGGTGTGGAGATTTGCAGG + Intergenic
1136413693 16:30091328-30091350 GGGCTGGGGTGGAGACCCCTGGG + Intronic
1136613264 16:31380060-31380082 GTGCTGGTGAGGAGGGCTCTGGG + Exonic
1136748696 16:32614423-32614445 GGGGTTGTGTTGGGGCCTGTGGG - Intergenic
1137671510 16:50282104-50282126 GGGCTGCTTTGGGGCCCTGTTGG - Intronic
1138102969 16:54269164-54269186 AGCCTGGTGTGGAGACCTCTTGG + Intronic
1138461771 16:57153132-57153154 GAGATGGTGTGGAGGCCTCGAGG - Exonic
1138615160 16:58159411-58159433 GGGCTAGAGTGGTGTCCTGTTGG - Intronic
1139419414 16:66841132-66841154 GGGCTGTGATGGAGGCCTGGGGG - Intronic
1139527985 16:67528433-67528455 GGGCTGTTGTGAAGGCCTTGGGG - Intronic
1141072630 16:80972077-80972099 GGCCTGGGCTAGAGGCCTGTGGG - Exonic
1141410341 16:83828759-83828781 GGACTGGAGTGAAGGCCTCTGGG + Intergenic
1141551689 16:84810588-84810610 GGCCTGGTGTGGAGGGATCTGGG + Intergenic
1141658616 16:85429662-85429684 GGACAGGGGAGGAGGCCTGTGGG - Intergenic
1141682566 16:85553207-85553229 GGGCTGGAGCGGAGGCCCGGCGG + Intergenic
1141703209 16:85651751-85651773 AGGCTGGTGGGGAGGCCTCCAGG - Intronic
1142157225 16:88538087-88538109 GGGCTGGTGGGGAGACAGGTGGG - Intergenic
1142247687 16:88977307-88977329 GGGCAGGTGTGCAGGCCTGAGGG + Intergenic
1142356244 16:89603514-89603536 GGGCTGGAGGGGAGCCCTGGGGG + Intergenic
1142356279 16:89603596-89603618 GGGCTGGAGGGGAGCCCTGGAGG + Intergenic
1142356297 16:89603637-89603659 GGGCTGGAGGGGAGCCCTGGGGG + Intergenic
1142356351 16:89603758-89603780 GGGCTGGAGGGGAGCCCTGGAGG + Intergenic
1142356484 16:89604119-89604141 GGGCTGGAGGGGAGCCCTGGGGG + Intergenic
1203050830 16_KI270728v1_random:873637-873659 GGGGTTGTGTTGGGGCCTGTGGG - Intergenic
1144473292 17:15563296-15563318 GGCCGGGAGTGGAGGGCTGTGGG - Intronic
1144618405 17:16798066-16798088 GGGCCTGTGTAGAGGCCTTTAGG + Intronic
1144894301 17:18517627-18517649 GGGCCTGTGTAGAGGCCTTTAGG - Intergenic
1144923190 17:18781424-18781446 GGCCGGGAGTGGAGGGCTGTGGG + Intronic
1145137931 17:20426615-20426637 GGGCCTGTGTAGAGGCCTTTAGG + Intergenic
1146466631 17:33091323-33091345 GGGTGAGTGTGGAGGGCTGTTGG + Intronic
1146485981 17:33242928-33242950 GGGCTGGTGTGCAGGAGTGAGGG - Intronic
1147038750 17:37701162-37701184 TGGGAGGTGTTGAGGCCTGTGGG + Exonic
1147337962 17:39738433-39738455 CGGCCGGTCTGGAGGCCGGTAGG + Intronic
1147981002 17:44273943-44273965 GGGCAGGTTTGGAGAGCTGTGGG + Intergenic
1148351218 17:46943355-46943377 GGGGTGGTGGGGAGGGCTGGGGG - Intronic
1149779034 17:59381759-59381781 AGGCTGGTGTGCAGGCCTCCAGG - Intronic
1150414406 17:64975536-64975558 TGAGTGGTGTCGAGGCCTGTTGG - Intergenic
1150797230 17:68248088-68248110 TGGGTGGTATCGAGGCCTGTCGG + Exonic
1151334649 17:73432668-73432690 GGGCTGGAGGGGAGGGCTGGGGG + Intronic
1151354665 17:73551260-73551282 GGGCTGGGGTGGGAGCGTGTGGG - Intronic
1151478340 17:74356023-74356045 GGGCAGGTGTGAAGGCCAGTGGG - Intergenic
1151492746 17:74442554-74442576 GTGCTGATCTGGAGGCCTGGGGG + Intronic
1151731187 17:75912241-75912263 GGGCTGGGGTCCAGGCCAGTTGG + Exonic
1151751364 17:76040146-76040168 GGACTGGGGTGCAGGCCTGTTGG + Intronic
1151759335 17:76091647-76091669 GGGCTGGGCTGGGGGCCTGCTGG - Intronic
1151785712 17:76273941-76273963 GGGGTGGTCTGGAGGCACGTGGG + Intergenic
1152260187 17:79262605-79262627 AGGCTGGTGGGAAGGGCTGTGGG + Intronic
1152558279 17:81065427-81065449 GGGCTGGTGTGGAGACCCAAGGG + Intronic
1152650698 17:81491331-81491353 GGGCAGGGGTACAGGCCTGTGGG - Intergenic
1152923232 17:83076278-83076300 TTGCTGGGGTGGAGGGCTGTGGG - Intergenic
1153915316 18:9739724-9739746 GGGCTTGTTTGGTGGCTTGTGGG + Intronic
1154177509 18:12094618-12094640 GGGTTGGGGTGGAGGACTGGTGG + Intronic
1156027227 18:32669155-32669177 GGCCTGGTGTGGAAGCTTGGTGG + Intergenic
1158458818 18:57630225-57630247 GGCCTGGTACGGTGGCCTGTGGG - Intergenic
1159102194 18:63969988-63970010 GGGCCTGTGTGGATGTCTGTGGG - Exonic
1160787459 19:907655-907677 GGCCTGGAGGAGAGGCCTGTGGG - Intronic
1160991282 19:1861334-1861356 GGGCTGAAGTGGGAGCCTGTTGG - Intronic
1161490470 19:4558294-4558316 GGGCGGGGGTGGAGTCCCGTGGG - Intronic
1163233505 19:16018735-16018757 GGGCTGAGGTGAAGGGCTGTGGG - Intergenic
1163552885 19:17975230-17975252 GGGCTGGTGTGGGGGGATCTGGG - Intronic
1163854980 19:19694533-19694555 GGGCTGGGGTGGTGGGCAGTTGG - Intergenic
1164156986 19:22602999-22603021 GAGCTGGTGTTGCGGCTTGTGGG + Intergenic
1165175751 19:33928567-33928589 GGGCAGGTGTGCAGGTGTGTGGG + Intergenic
1165316060 19:35056036-35056058 AGGCTGGTGTGGGGGACTGGGGG - Intronic
1165484797 19:36089129-36089151 GGGCTGGGGTGGGGGGTTGTCGG + Intronic
1165954663 19:39494755-39494777 GGGATGGTCGGGAGGCCTCTTGG + Intergenic
1166104618 19:40591114-40591136 GGGCTGGTGTGGGTGGCCGTCGG - Exonic
1167277010 19:48544993-48545015 GGGCTGGGCTGGAGGCCACTTGG - Intergenic
1167487206 19:49769605-49769627 GGGCGGGTGTGGAGGGGAGTGGG + Intronic
1167538964 19:50073421-50073443 GGTCTGGTCTGGAGACCTGGGGG + Intergenic
925007743 2:457484-457506 TGGCAGGTGTGGAGGTCTGAGGG - Intergenic
927706111 2:25297429-25297451 AGGCTGGGGTGCAGGCCTATGGG - Intronic
929449702 2:42028468-42028490 GAGCTGGTGAGCAGGGCTGTGGG - Intergenic
929579670 2:43073975-43073997 GGGCTGGGGTGGAGGATTGTGGG - Intergenic
930028706 2:47045325-47045347 GAGCTGGGGTGGAGCCCTGGAGG - Intronic
931218684 2:60269684-60269706 GGGCTGTAGTGGAGGCTTGCAGG + Intergenic
931720145 2:65061624-65061646 GGGCTGGTGTGGGGGACTGTGGG + Intronic
932780864 2:74557427-74557449 GGGCCTGTGTGGAGGCCTCAGGG + Exonic
934979800 2:98830362-98830384 GGGCCTGTGTGTAAGCCTGTGGG + Intronic
935241471 2:101182090-101182112 GGCCAGGTGTGGTGGCCTTTGGG + Intronic
935394059 2:102586825-102586847 AGGTTGGTGTTGAGGCCTGGAGG - Intergenic
935632350 2:105222633-105222655 GGGCTGGGGTGGGGGCCGGAGGG - Intergenic
935715818 2:105938067-105938089 GTGCTGGAGTGGGGGCCTGGTGG + Intergenic
937098378 2:119250296-119250318 GGGGCGGTGTGGAGGCCTGAAGG + Intronic
937358800 2:121214623-121214645 GGGCTGGTAGGGAGGCCTGTGGG + Intergenic
938051916 2:128181562-128181584 GGGCTGAAGTGGAAGGCTGTGGG - Intronic
938277425 2:130038426-130038448 GTGCAGGTGGGGAGGCCTCTGGG - Intergenic
938328396 2:130429229-130429251 GTGCAGGTGGGGAGGCCTCTGGG - Intergenic
938361551 2:130692265-130692287 GTGCAGGTGGGGAGGCCTCTGGG + Intergenic
938437960 2:131298954-131298976 GTGCAGGTGGGGAGGCCTCTGGG + Intronic
938540277 2:132279609-132279631 GGGGTGGGGTGGGGTCCTGTGGG - Intergenic
940287660 2:152048464-152048486 GGGATGAAGTGGAGGCCAGTTGG - Intronic
944119675 2:196227567-196227589 GGGCTGGTGTAGTGACCTGGGGG - Intronic
944289044 2:197983694-197983716 AGCCTGGTGATGAGGCCTGTAGG + Intronic
944442298 2:199754491-199754513 GGTCTGGTGTGGTGGCCTCCTGG - Intergenic
944474056 2:200085765-200085787 GTGCTGGTGTACAGGCCTGCAGG + Intergenic
946429648 2:219618269-219618291 TGGCTGGGGTAGAGGCCTCTTGG + Intergenic
947699390 2:232219742-232219764 GAGTTGCTGTGGAAGCCTGTAGG - Intronic
948409054 2:237744957-237744979 GGCATGGTGTGGGGGCCTGGAGG - Intronic
948961292 2:241340255-241340277 GTGCTGGTGTTGATGCCGGTTGG + Intronic
1168829936 20:840343-840365 GGGCTGGGGCTGAGGCCTGGGGG + Intronic
1169080596 20:2795946-2795968 GGGCGGCAGTGGAGGTCTGTGGG - Intronic
1170669219 20:18415323-18415345 CGGCTGGTGTGGAGCCATGGTGG - Exonic
1170945514 20:20887845-20887867 GGGCTCGGGGGGAGGCCTGCTGG - Intergenic
1171334564 20:24371508-24371530 GGTCTGGCCTTGAGGCCTGTCGG + Intergenic
1171341370 20:24431702-24431724 GGGGTGGTTTGGAAGGCTGTGGG - Intergenic
1171869203 20:30512613-30512635 GGGGTGGGGTGGGGTCCTGTGGG - Intergenic
1172090462 20:32428189-32428211 CGGCTGATGTGGAGAGCTGTGGG + Exonic
1172176577 20:32976156-32976178 GGGCTGGTGGCGGGGCCTCTGGG + Intergenic
1172295915 20:33811280-33811302 GGCCGGGCGTGGGGGCCTGTGGG + Intergenic
1172439458 20:34955494-34955516 GGGCCGGTGTCGGGGCATGTAGG - Intronic
1172658497 20:36550683-36550705 GGCCTGGCGTTGAGGCCTGCAGG - Exonic
1172802995 20:37591395-37591417 CAGCTGGAGTGGAGGCGTGTGGG - Intergenic
1173385342 20:42582280-42582302 GGCCTGGGGTGGAGGCCCCTGGG + Intronic
1175222755 20:57426780-57426802 AGGCTGGTTTGGAGGCCTAGGGG - Intergenic
1175327775 20:58141750-58141772 GGGCAGGTGGCCAGGCCTGTGGG - Intergenic
1175982505 20:62746151-62746173 GGGGTAGTGTGGGGGCCTGGTGG - Intronic
1176103755 20:63376103-63376125 GGGCTGGAGTGCAGGGCTGGTGG - Intronic
1176197345 20:63843619-63843641 GGGCTGGGGTCTGGGCCTGTGGG - Intergenic
1176264734 20:64203236-64203258 CAGCTGCTGTGGAGGCCTGTGGG - Intronic
1178376256 21:32070069-32070091 GGCCTGGTCTGGAGGCTTGGGGG - Intergenic
1179344853 21:40546911-40546933 GGGCTGGGGTGGGAGCCTGGAGG + Intronic
1179471618 21:41614212-41614234 GGGCTAGGGTGGAGGCATCTTGG - Intergenic
1179639781 21:42739481-42739503 GGGCTGGCGGGGAGGTCTGCAGG - Intronic
1179732089 21:43373728-43373750 GGTCTGGTGCAGAGCCCTGTGGG - Intergenic
1180086175 21:45508930-45508952 GGACTGGGGTGCAGGCCTGGGGG + Intronic
1180626858 22:17199366-17199388 AGCCTGGTGGGGAGGCATGTGGG - Intronic
1181265765 22:21629729-21629751 AGGTTGGCGTGGAGGCCCGTGGG + Exonic
1181468735 22:23125256-23125278 GTCCTGGTGTGGAGGTCTGGGGG + Intronic
1181615287 22:24050043-24050065 TGGCTGGGCTGGAGGGCTGTGGG - Intronic
1182146603 22:28000616-28000638 AGGCGGGTGCGGAGCCCTGTGGG + Intronic
1182358706 22:29734448-29734470 GGCCTGGTCTGGAAGCCTGGGGG - Intronic
1182847907 22:33446677-33446699 GGGCTGGTCTGGGGGCCTTGTGG + Intronic
1183265004 22:36819472-36819494 GGGCTGGTGGGAAGTCCTGTCGG + Exonic
1183404688 22:37624701-37624723 GAGCTGGAGTGGAGGCCTGGAGG + Intronic
1183406009 22:37631019-37631041 GGGCTGCTGCGGAGGCCTGGGGG - Exonic
1183648191 22:39138812-39138834 GGATTGGTGGGCAGGCCTGTGGG - Intronic
1183677364 22:39307046-39307068 GGCCTGGGGTGGAGGTCTGCTGG + Intergenic
1184335250 22:43849055-43849077 GGACTTGGGTCGAGGCCTGTGGG + Intronic
1184408679 22:44314160-44314182 GGTCTGGTGTGGACACCTGAAGG + Intergenic
1185039629 22:48497611-48497633 GGGCGGGGCTGGAGGCCTGGGGG + Intronic
1185039672 22:48497728-48497750 GGGCGGGGCTGGAGGCCTGGGGG + Intronic
1185039715 22:48497845-48497867 GGGCGGGGCTGGAGGCCTGGGGG + Intronic
1185039729 22:48497883-48497905 GGGCAGGTTTGGAGGCCTGGAGG + Intronic
1185110543 22:48897909-48897931 GGGCAGGGGTGGAGGCCTCTGGG - Intergenic
1185244079 22:49763982-49764004 GGGCTGGTGGGGATGCCAGCAGG - Intergenic
1185274268 22:49943650-49943672 GGGCTGGTGTGGGGCGCTGGGGG - Intergenic
949892534 3:8744038-8744060 GGGCCTGTGTGGTGGCCTGCAGG - Intronic
950650489 3:14403849-14403871 GGACTGGAGAGGAGACCTGTGGG + Intronic
952478875 3:33739249-33739271 GGGCTGGGTTGGAGGGATGTGGG + Intergenic
953049466 3:39327732-39327754 GGGCTGGTGTGGGCCCCTGCAGG - Intergenic
953380634 3:42469594-42469616 TGGCTCCTGTGGAGGCCTGCTGG + Intergenic
953699341 3:45183903-45183925 GGGTTGGGGTGGAGGGCAGTGGG + Intergenic
955071446 3:55575638-55575660 TGGCTGGTGGGGAGCCCTCTGGG - Intronic
955286535 3:57646979-57647001 GGAATTGGGTGGAGGCCTGTTGG + Intronic
956264398 3:67380832-67380854 GGGCTGGTGTGGAAGGCACTTGG - Intronic
956544948 3:70390666-70390688 GGACTGGTGGGGAGGTATGTGGG - Intergenic
957530556 3:81435672-81435694 GGGCTGGTGTGGAGGTGTAGGGG + Intergenic
960993263 3:123325294-123325316 TGGCTGGTGGGGCAGCCTGTGGG - Intronic
961181494 3:124881646-124881668 GAGCTGGTATGGAGGCCATTTGG - Intronic
961474234 3:127136799-127136821 AGGCTGGTGTGGAGGTCTGCAGG - Intergenic
963001799 3:140688331-140688353 AGGTGGGTCTGGAGGCCTGTGGG + Exonic
963284357 3:143418552-143418574 TGGAAGGTGAGGAGGCCTGTTGG + Intronic
964309520 3:155377615-155377637 GGGCTGGAGTCCAGGCCTGTAGG - Intronic
964831217 3:160886060-160886082 CAGCTGGTGTGTTGGCCTGTGGG - Intronic
965329355 3:167351602-167351624 AGGCCAGTGTGGAGGCCTATGGG - Intronic
966927190 3:184652456-184652478 GGGCTGGTTTGCAGGGCTGTGGG - Intronic
968275209 3:197436258-197436280 GGGTTGGAGTGGAGCCCTGCTGG + Intergenic
968275219 3:197436301-197436323 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275240 3:197436387-197436409 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275317 3:197436731-197436753 GGGTTGGAGTGGAGCTCTGTTGG + Intergenic
968275395 3:197437118-197437140 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275414 3:197437204-197437226 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275432 3:197437290-197437312 GGGTTGGAGTGGAGCCCTCTTGG + Intergenic
968275451 3:197437376-197437398 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275512 3:197437677-197437699 GGGTTGGAGTGGAGCCCTGCTGG + Intergenic
968275522 3:197437720-197437742 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275543 3:197437806-197437828 GGGTTGGAGTGGAGCCCTGCTGG + Intergenic
968275555 3:197437849-197437871 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275632 3:197438193-197438215 GGGTTGGAGTGGAGCTCTGTTGG + Intergenic
968461920 4:730442-730464 GGGCTGGTCTCGGTGCCTGTCGG - Intronic
968601068 4:1509558-1509580 GGTCTGGTGTGTGGGCCTCTGGG - Intergenic
968648994 4:1753042-1753064 GTGCTGGTGGTGAGGCCTCTTGG + Intergenic
968730896 4:2268735-2268757 AGGCTGGTCTGGAGGGCTGCCGG + Intergenic
968770356 4:2501715-2501737 GTGCTGCTGAGGAGGACTGTGGG + Intronic
969308620 4:6339579-6339601 GGGCTGGGGTGGAGGCCGATTGG + Intronic
969460630 4:7326979-7327001 GGGCAGGGGTGGAGGCCCGGAGG - Intronic
970838445 4:20438611-20438633 GGGCTGGTGTGGGAGCCAGTAGG - Intronic
973567508 4:52203068-52203090 GGGCTGATGTGGAGAGGTGTGGG - Intergenic
974079330 4:57195979-57196001 TGGATGCTGTGGGGGCCTGTTGG + Intergenic
976075845 4:81298307-81298329 GGGCTGGTGTTGAGTGCTTTTGG - Intergenic
978203126 4:106046586-106046608 GGGATGGTGAGGAGGCCTGTTGG + Exonic
980988505 4:139718392-139718414 AGGCTGGTGTGGAGGCAAGGAGG + Exonic
982274981 4:153629301-153629323 GGGCTGGTGGAGAGGGCAGTGGG - Intronic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
983277417 4:165635517-165635539 GTGCTGTTGTGGAGGCATGGCGG + Intergenic
985589013 5:755249-755271 GGGAGGGTGTTGAGGCCTGTGGG + Intronic
985603693 5:847765-847787 GGGAGGGTGTTGAGGCCTGTGGG + Intronic
985781885 5:1875864-1875886 GGGCTGGGGTGGGGGCGTCTGGG + Intergenic
986002928 5:3644230-3644252 GGGCTGGTGCAGAGGGCTGGGGG + Intergenic
989548971 5:42709893-42709915 TGGCTGGTGTGGAGGGTTGAGGG + Intronic
990667920 5:58094539-58094561 GGGCTCTTCTGGAGGGCTGTGGG + Intergenic
991203819 5:64025822-64025844 AGGCTGGTGGGGAGGTCAGTGGG + Intergenic
996573386 5:124957278-124957300 GAGCTGGTGAGAAGGTCTGTGGG + Intergenic
997523331 5:134537176-134537198 GGGCTGGTGGGGAGCCTTGCAGG - Intronic
998655988 5:144180328-144180350 GTGCTTCTGTGGAGTCCTGTTGG - Intronic
998693131 5:144610035-144610057 GCGCTGGAGGTGAGGCCTGTAGG - Intergenic
999174574 5:149623017-149623039 GTGCTGGAGGGGAGGGCTGTGGG - Intronic
999394104 5:151215611-151215633 GGGATGGTGTGGAGGGCTCCAGG - Intronic
1001018807 5:168165501-168165523 GGGCTGGTGGGGAGGGAGGTGGG - Intronic
1003286296 6:4736569-4736591 GGGCTGGTTTGGTGGCCTCTTGG + Intronic
1004177866 6:13355894-13355916 GGGCTGGGGTGGAGGAGTGAGGG + Intergenic
1004334438 6:14751445-14751467 GGGCTGGTGGGGACCCTTGTGGG - Intergenic
1005213659 6:23499116-23499138 GGGCAGGTGTGCAGCCCTGGAGG - Intergenic
1006025133 6:31141937-31141959 GGGCTCCTGTGGAGGCCAGGAGG - Intergenic
1006458717 6:34145884-34145906 GGGCGGGTGTGGAGGGGTGGCGG - Intronic
1007637453 6:43307948-43307970 TGTCTGGGGTGAAGGCCTGTGGG - Intronic
1007878915 6:45140164-45140186 GGGGTGGTTTGCAGGCCAGTGGG - Intronic
1009969528 6:70612307-70612329 GGGGTGGTGTGGAGGTGGGTAGG - Intergenic
1015660122 6:135566103-135566125 GGGCTGGTGTGCTGCCATGTGGG + Intergenic
1017523238 6:155220408-155220430 AGGCTGGTCTGGAGGCCTGGCGG + Intronic
1018089011 6:160329498-160329520 GCCATGGTGGGGAGGCCTGTGGG + Intergenic
1019530485 7:1500560-1500582 GGGCTAGTGCTGAGGCCTGTGGG - Intronic
1019599303 7:1873455-1873477 GGGCAGGTGGGGAGCCCTGGTGG + Intronic
1020581059 7:10003003-10003025 GAGCAGGTGTGCAGTCCTGTGGG + Intergenic
1022254414 7:28641559-28641581 TGGCAGATGTGGAGGCCTGCAGG + Intronic
1022485275 7:30772970-30772992 GGGGTGGTGGGGAGGGATGTGGG - Intronic
1022993176 7:35728278-35728300 GGGCTGGTGTGGAGTTGTGAAGG - Intergenic
1023955528 7:44884373-44884395 GTGGTTGGGTGGAGGCCTGTAGG + Exonic
1023986563 7:45100541-45100563 GGGCAGGTGTGCAGAGCTGTTGG - Intronic
1025113575 7:56239295-56239317 GGTCTGGTGTAGAGGACTGATGG - Intergenic
1026777255 7:73238401-73238423 GTGCTGGGGAGGAGGCCTCTCGG + Intergenic
1026846719 7:73702809-73702831 GGGCTGGAGTGGAGGGCAGGGGG + Intronic
1027018103 7:74791770-74791792 GTGCTGGGGAGGAGGCCTCTCGG + Intergenic
1027069924 7:75154142-75154164 GTGCTGGGGAGGAGGCCTCTCGG - Intergenic
1029146308 7:98448589-98448611 GGTCTGGTGTTGAGGGCTGATGG + Intergenic
1029419350 7:100464443-100464465 GGGCTGCTGTGAAGGACTGCAGG - Intronic
1029443579 7:100601117-100601139 GGCCTGGTGTGGAAGCCTTGGGG + Exonic
1032390548 7:131552760-131552782 GGGCTGGGGTGGGGGAATGTGGG - Intronic
1034219020 7:149430262-149430284 GGGCTGGTGTAAAGGACTGAGGG - Intergenic
1034531754 7:151700365-151700387 GGTCTGGGGTGGGGGCCTGGAGG - Intronic
1035045761 7:155964288-155964310 AGGCTGGCGGGGAGGGCTGTGGG + Intronic
1036934707 8:12990007-12990029 GGGCTGGTGTAGGGGAATGTTGG + Intronic
1038372352 8:27006833-27006855 GGGGTGGGGAGGAGGCCTGGAGG + Intergenic
1041022104 8:53648382-53648404 AAGCTGGTGTGGAGGCCAGGAGG - Intergenic
1043213345 8:77552504-77552526 GTGCTGGTCTGGAAGGCTGTGGG + Intergenic
1043909037 8:85839190-85839212 GGACTGGGGTGCAGGACTGTGGG + Intergenic
1043982419 8:86657708-86657730 GAGCTGGTGTTGCGGCTTGTGGG - Intronic
1045217530 8:100163098-100163120 AGGGTGGTGGGGAGGCCTGACGG + Intronic
1046656587 8:116901280-116901302 GGGCAGGGGTGGAGGGCTGAGGG - Intergenic
1047047501 8:121071225-121071247 ATGCTGTTGTGGAGGCCTTTGGG - Intergenic
1047407258 8:124595926-124595948 AGGCTGCTGGGGAGGCCTCTGGG + Intronic
1047601689 8:126432119-126432141 GTGCTGGGTTGGAGGGCTGTTGG + Intergenic
1048995865 8:139793404-139793426 CTGCTGGGGTGGAGCCCTGTGGG - Intronic
1049003015 8:139838061-139838083 GTCCTGGTGTGGAGGCCTGTGGG - Intronic
1049265144 8:141663937-141663959 GGGCTGGTGGGGAGAGCTGCTGG + Intergenic
1049434894 8:142581951-142581973 GGTCTGGGGTGGATACCTGTGGG - Intergenic
1049507935 8:143013775-143013797 GGGCTGGCCAGGAGGCCTGACGG - Intergenic
1049589595 8:143451053-143451075 GGGCTGCTGTGGGGGACTGCGGG + Intronic
1049830658 8:144699311-144699333 GGGGTGGTGTGGGGGGCTATGGG + Intergenic
1053121832 9:35553150-35553172 GGGCAGGTGTGGAAGTCTGAAGG + Intronic
1054740340 9:68800168-68800190 GGGCTGGTGGAGATACCTGTGGG + Intronic
1055013198 9:71589555-71589577 TGGCTCCTGTGGAGGCCTGCTGG + Intergenic
1057421417 9:94916014-94916036 GTGGCGGTGTGGAGGCCTGGAGG - Intronic
1057721646 9:97536338-97536360 GGCCTGATGTGGAGGCAGGTGGG + Intronic
1058066530 9:100554606-100554628 GGGCTGGTGTGGAGGACAGTGGG + Intronic
1059625355 9:116058778-116058800 GGGATGGAGTGGAGGCCGGGTGG - Intergenic
1060778979 9:126397977-126397999 GAGCTGGTGTGCAGCCCTGCAGG - Intronic
1060941730 9:127546421-127546443 GGGCAGGTGTCCAGGCCCGTGGG - Intronic
1061239410 9:129360423-129360445 GAGCCTGTGTGGAGGGCTGTGGG - Intergenic
1062392692 9:136340262-136340284 GGCCGGGTGGGGAGGCCTGCAGG + Intronic
1062403861 9:136384302-136384324 TGGCTGGTGCGGAAGCCTGGGGG - Intronic
1062459086 9:136655376-136655398 GAGCTGGTGTGGAGACATGCAGG + Intergenic
1062494893 9:136827025-136827047 GGGCTGGTGTGGAGGCCTGTGGG + Intronic
1062578211 9:137218283-137218305 GGGCTGGCGTGAGGGCCCGTCGG - Intergenic
1185628278 X:1497827-1497849 GGACCGGCTTGGAGGCCTGTGGG + Intronic
1185642397 X:1595928-1595950 GGGTGTGTGTGCAGGCCTGTGGG + Intronic
1187425708 X:19175740-19175762 GGGCTGGTGTGGTCCCCTGGAGG + Intergenic
1187500313 X:19833484-19833506 GGGAAGGTGAGGAGGACTGTGGG - Intronic
1189010802 X:37043827-37043849 GGGCTGGTGCGGAGCCATGCGGG + Intergenic
1190709996 X:53060667-53060689 GGGCAGGGGTGAAGGGCTGTAGG - Intronic
1192202005 X:69072486-69072508 GGGAGGTTTTGGAGGCCTGTGGG - Intergenic
1192264465 X:69529431-69529453 GGGCAAGTGTCGAGGGCTGTGGG + Intronic
1192633071 X:72791837-72791859 GGGCCGGAGAGGAGGGCTGTAGG - Intronic
1192648638 X:72928964-72928986 GGGCCGGAGAGGAGGGCTGTAGG + Intronic
1193023748 X:76821607-76821629 GGCCTGGAGTGTAGGGCTGTAGG + Intergenic
1193066429 X:77265133-77265155 GGGCTGGTGTTGAGTGCTGATGG - Intergenic
1196403688 X:115342463-115342485 GGGCTGTGGTGGAAACCTGTTGG - Intergenic
1196468150 X:115993675-115993697 GGGCTGGTGTGTGGCCCTGAGGG - Intergenic
1197781595 X:130165632-130165654 GTTCCGGTGTGGAGGCCTGGCGG - Exonic
1200216222 X:154369325-154369347 GGACTGGGGTGGGGGCCTGATGG - Intronic
1200244952 X:154517998-154518020 GGGATGGTTTGGATTCCTGTGGG + Intergenic