ID: 1062497161

View in Genome Browser
Species Human (GRCh38)
Location 9:136837384-136837406
Sequence CGTCCCCACTGGCGGCCAAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 3, 2: 0, 3: 2, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062497151_1062497161 23 Left 1062497151 9:136837338-136837360 CCTTTCAGCTTCCTGGAGATGAT 0: 1
1: 1
2: 2
3: 27
4: 188
Right 1062497161 9:136837384-136837406 CGTCCCCACTGGCGGCCAACGGG 0: 1
1: 3
2: 0
3: 2
4: 60
1062497149_1062497161 30 Left 1062497149 9:136837331-136837353 CCTTCTGCCTTTCAGCTTCCTGG 0: 1
1: 3
2: 7
3: 71
4: 578
Right 1062497161 9:136837384-136837406 CGTCCCCACTGGCGGCCAACGGG 0: 1
1: 3
2: 0
3: 2
4: 60
1062497154_1062497161 12 Left 1062497154 9:136837349-136837371 CCTGGAGATGATGGAGGCTCGCA 0: 1
1: 1
2: 2
3: 13
4: 116
Right 1062497161 9:136837384-136837406 CGTCCCCACTGGCGGCCAACGGG 0: 1
1: 3
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062497161 Original CRISPR CGTCCCCACTGGCGGCCAAC GGG Exonic
901425703 1:9181409-9181431 CTTCCCCACTGGCGGCTCACAGG + Intergenic
901513509 1:9730271-9730293 CGTCCTCTCTGGCCGCCATCCGG - Exonic
904951056 1:34239163-34239185 CTGCCCCACTGGCGGCCAATAGG + Intergenic
922937746 1:229434356-229434378 CATCCCCTCCGGCGGGCAACTGG - Intergenic
1065526095 10:26622556-26622578 AGTCCCCACTGGCTGCGGACGGG + Intergenic
1069757622 10:70782779-70782801 AGTCCCCACTGGAGGCCTGCTGG + Intronic
1071571193 10:86698388-86698410 GGTGCCCACTGGTGGCCAAAGGG - Intronic
1076512274 10:131021355-131021377 TGGCCTCACTGGCGGCCAGCGGG + Intergenic
1078662313 11:13297442-13297464 CCTCCTCACTGCCGGCCCACAGG - Intronic
1079098174 11:17524412-17524434 CGGCCCCAGTGGGGGCCCACTGG - Intronic
1079604042 11:22343344-22343366 CGTCTCGGCTGGCAGCCAACAGG + Exonic
1081245628 11:40763422-40763444 CATCCCCACTGCTGCCCAACAGG + Intronic
1083784059 11:64933814-64933836 GACCCCCACTGGCGGCCACCTGG - Exonic
1084068350 11:66718414-66718436 CGTCCCCACAGGGGGCCCCCGGG + Intronic
1096185392 12:49577122-49577144 CATCCCAACTGGCTGCCCACTGG - Intronic
1096198270 12:49663138-49663160 CTTCCTCTCTGGGGGCCAACAGG + Intronic
1099365229 12:81759279-81759301 CGTCCTCACCGGCTGCCAGCAGG - Exonic
1113911673 13:113844267-113844289 CGTCCCCAAGTGCGGCCAGCTGG - Intronic
1115235840 14:31207818-31207840 CGACCCCGCCGGCGGCCACCTGG + Intergenic
1117639874 14:57786440-57786462 CCTCCTCACAGGAGGCCAACTGG + Intronic
1123826978 15:24092242-24092264 CGTCTCCACTGGGGGCCTAGTGG - Intergenic
1132896362 16:2231124-2231146 CATCTCCACTAGAGGCCAACAGG - Intronic
1135106586 16:19655079-19655101 GGTCCCCACTGAGGGACAACTGG + Intronic
1135805526 16:25539059-25539081 GCTCCCCACTGGAGCCCAACAGG + Intergenic
1141737454 16:85863035-85863057 CTTCCCCACTGGCAGCCTCCTGG + Intergenic
1143011107 17:3866637-3866659 GGTCACCACTGGCTGCCTACTGG + Intronic
1143151070 17:4807796-4807818 CTTCCCCACTGGGGACGAACTGG + Exonic
1144632173 17:16879828-16879850 CCTGCCCACAGGTGGCCAACCGG + Intergenic
1147677911 17:42220056-42220078 CGTCCCCTCTGGGGGCACACGGG + Intronic
1147688137 17:42299516-42299538 CGTCCCCTCTGGGGGCACACGGG - Intronic
1152901906 17:82947179-82947201 CCTCCCCTCTGGTGACCAACAGG - Intronic
1154503108 18:15006125-15006147 CGTCCCCACTGGCGGCCAAGGGG - Intergenic
1155214839 18:23634113-23634135 CGTACTGACTGGCAGCCAACAGG + Exonic
1161326354 19:3666014-3666036 CCTGCCCCCTGGCGGCCACCTGG - Intronic
1162371621 19:10283514-10283536 CTTGCCCACTGGCTGCCAAGAGG - Exonic
1163722495 19:18904918-18904940 TGTCCCCACTTGGGGCCCACCGG + Intronic
1165782999 19:38444586-38444608 GCTCCCCACTGGCGGTCGACAGG - Exonic
929539776 2:42810732-42810754 CGTCCCCATTGGCCGCAAGCAGG + Intergenic
932291085 2:70580258-70580280 CCTCCCCATGAGCGGCCAACTGG + Intergenic
932330164 2:70894248-70894270 GGTCTCCACTGGCTGCCGACTGG + Intergenic
938502277 2:131836295-131836317 CGTCCCCACTGGCGGCCAAGGGG - Intergenic
942531551 2:176915497-176915519 CTTCCCCACTGTCTGCCACCTGG + Intergenic
944669103 2:201980677-201980699 TGTCCCCACTGCCTGCCAGCAGG + Intergenic
1170706131 20:18746135-18746157 CATCACCATTGGCTGCCAACAGG - Intronic
1175978716 20:62726475-62726497 CATCCCCACTGCCTGCCCACCGG + Intronic
1178585145 21:33865427-33865449 TGTTCCCACTAGAGGCCAACAGG + Intronic
1180717448 22:17881455-17881477 CGTCCCACCTGGGGGCCCACGGG - Intronic
952898404 3:38094397-38094419 TGTGCCTACTGGCTGCCAACAGG - Intronic
954713810 3:52517372-52517394 CATCCCCACTGGCCCCCAGCAGG + Exonic
956406429 3:68932703-68932725 CGCCCCCACTGCCGGCCTCCAGG + Intergenic
958636500 3:96753360-96753382 CGTCTCCACTGGGGGCCCAGTGG - Intergenic
964451268 3:156816051-156816073 CGCCCCCACCGGCGACCACCTGG + Intergenic
975683076 4:76896130-76896152 CCTCCCCACTGGGGACCCACAGG + Exonic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
997608165 5:135191536-135191558 CAGCACCACCGGCGGCCAACAGG - Intronic
1001434489 5:171688707-171688729 TGGCCCCACTTGCAGCCAACAGG + Intergenic
1003475897 6:6482381-6482403 CTTCCCCACTGGCTTCCCACTGG - Intergenic
1005706130 6:28455412-28455434 CGTCCCCATTGCCAGCCAATGGG + Intergenic
1036696320 8:10977331-10977353 CCTGCCCTCTGGTGGCCAACTGG + Intronic
1039797044 8:40924573-40924595 CATCCCCACTGGCAGCAAAGCGG + Intergenic
1040080126 8:43276296-43276318 CGTCCCCGCTGGCGGCCAACAGG - Intergenic
1046990349 8:120445515-120445537 CCTCCCTACTGGCCGCCGACGGG - Exonic
1052370754 9:27661769-27661791 CATCCCCACTGATGGCCATCTGG - Intergenic
1061133384 9:128720534-128720556 CCTCCTCACTGCCCGCCAACAGG + Exonic
1062497161 9:136837384-136837406 CGTCCCCACTGGCGGCCAACGGG + Exonic
1203793730 EBV:165072-165094 CGGCCACACAGGAGGCCAACAGG - Intergenic