ID: 1062497846

View in Genome Browser
Species Human (GRCh38)
Location 9:136839981-136840003
Sequence TGCTCCTGGCAGCCCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 352}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062497838_1062497846 19 Left 1062497838 9:136839939-136839961 CCGCTGGCCGGGGTCCTCTCCTG 0: 1
1: 0
2: 7
3: 31
4: 245
Right 1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG 0: 1
1: 0
2: 6
3: 40
4: 352
1062497843_1062497846 -7 Left 1062497843 9:136839965-136839987 CCAGGATGCTGTGCCATGCTCCT 0: 1
1: 0
2: 1
3: 22
4: 266
Right 1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG 0: 1
1: 0
2: 6
3: 40
4: 352
1062497842_1062497846 0 Left 1062497842 9:136839958-136839980 CCTGAGTCCAGGATGCTGTGCCA 0: 1
1: 0
2: 4
3: 16
4: 230
Right 1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG 0: 1
1: 0
2: 6
3: 40
4: 352
1062497839_1062497846 12 Left 1062497839 9:136839946-136839968 CCGGGGTCCTCTCCTGAGTCCAG 0: 1
1: 1
2: 1
3: 41
4: 349
Right 1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG 0: 1
1: 0
2: 6
3: 40
4: 352
1062497841_1062497846 5 Left 1062497841 9:136839953-136839975 CCTCTCCTGAGTCCAGGATGCTG 0: 1
1: 0
2: 2
3: 25
4: 295
Right 1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG 0: 1
1: 0
2: 6
3: 40
4: 352
1062497835_1062497846 30 Left 1062497835 9:136839928-136839950 CCAGCTGCTGGCCGCTGGCCGGG 0: 1
1: 0
2: 3
3: 27
4: 279
Right 1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG 0: 1
1: 0
2: 6
3: 40
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062497846 Original CRISPR TGCTCCTGGCAGCCCCCTGC AGG Intronic
900416895 1:2539505-2539527 CGCTCCTGGGGGACCCCTGCAGG - Intergenic
900422599 1:2562076-2562098 TGCTCCTGCCTGCCCCCTGTGGG + Intronic
900488220 1:2933539-2933561 TGCTCCCCGCAGACCCCTGTAGG + Intergenic
900488230 1:2933570-2933592 TGCTCCCCGCAGACCCCTGCAGG + Intergenic
900584255 1:3424874-3424896 TGCTCCTTGCAGCCTCCAGAGGG - Intronic
900626228 1:3609938-3609960 TGCCCCTGGAAGCCCCTGGCTGG + Intronic
900913827 1:5620594-5620616 TGCACATGGTAGCCCCCTGGTGG + Intergenic
902649823 1:17829838-17829860 TGCACCTGGCTGCCCCTGGCAGG - Intergenic
902724244 1:18324444-18324466 GGCTCATGACCGCCCCCTGCAGG - Intronic
904449116 1:30599725-30599747 TCCTCCTGACAGCCCCAGGCAGG + Intergenic
905594196 1:39191819-39191841 AGCTCCTCTCAGCTCCCTGCAGG - Intronic
905964660 1:42081667-42081689 TGCTACTGCCAACACCCTGCCGG - Intergenic
906608616 1:47187530-47187552 TGCTCCTGGCAGCTGGCTGAGGG - Intronic
906687130 1:47770013-47770035 TGCTCCAGGGAGCCCCTTGGAGG - Intronic
907338369 1:53715656-53715678 TCCTTCTTGCCGCCCCCTGCTGG - Intronic
907733163 1:57087233-57087255 TGCACCTGGCTGTCTCCTGCAGG - Intronic
908950974 1:69562296-69562318 TGCCCCTGACAGGCCCCTGTGGG - Intergenic
910835229 1:91501448-91501470 TTCTCCCTGCAGCCCCCTGCCGG + Intronic
915364949 1:155309827-155309849 TCCTGCTGCCAGCCCCCTACTGG + Exonic
917443417 1:175086464-175086486 TGCTCCTGCCTTCCCCATGCTGG + Intronic
917970592 1:180204239-180204261 AGCTCCTGGCTGCTCCGTGCAGG + Intergenic
918238120 1:182599551-182599573 TGCTCTGGGTGGCCCCCTGCAGG - Exonic
919650987 1:200148443-200148465 AGCCCCAGGCAGCCCCCTCCTGG + Intronic
920914975 1:210252052-210252074 TGCACCTCGGAGCCCCCTTCGGG + Intergenic
922752450 1:228076927-228076949 TGCTCCGTGCAGCCCCAAGCTGG + Intergenic
922755260 1:228093072-228093094 GGCTCCTGGCATCCTCCTGCTGG + Intronic
922891079 1:229062363-229062385 TCCTCCTGGCTGCCAGCTGCTGG - Intergenic
924710524 1:246527187-246527209 CTCTCCTGCCAGCCCCCTGCAGG + Intergenic
1062901165 10:1147919-1147941 GGCTCCTGGCTGACCTCTGCAGG + Intergenic
1063112056 10:3046257-3046279 TGCCCCTGGGAGCCCCCGGGAGG - Intergenic
1065079028 10:22109894-22109916 TGCGGCTGGCAGCCCCTTGATGG + Intergenic
1065965333 10:30766124-30766146 TGTTCCAGGCAGGACCCTGCCGG + Intergenic
1067078202 10:43199895-43199917 TGCTCCTTGCTGCCCAGTGCAGG + Intronic
1067238158 10:44468886-44468908 TGCTCCAGGCAGCTCCCAGATGG - Intergenic
1070428745 10:76315627-76315649 TGCTGAGGGCAGCTCCCTGCGGG + Intronic
1070727217 10:78800600-78800622 TGCTCCTGGAATCCACCTGCAGG - Intergenic
1070964294 10:80520191-80520213 AGCTCCTGGAAGGCTCCTGCAGG + Exonic
1072122994 10:92420295-92420317 AGCTCCCGGCGGCCCTCTGCTGG - Intergenic
1072175291 10:92914653-92914675 TGATCCTGGCTGCCCCCTAGAGG - Intronic
1072193534 10:93095454-93095476 TGCTCCAAGCTGCCTCCTGCTGG + Intergenic
1072537464 10:96374477-96374499 TGCTCCAGGCAGCACCCTCATGG + Intronic
1073320250 10:102611868-102611890 TGCCCCTGGCAGTCCCCAGCGGG + Intronic
1074276257 10:112005404-112005426 TCCTCCTGGCATCCCCCACCAGG - Intergenic
1074930820 10:118124123-118124145 TGTCCCTGGCACCCACCTGCAGG + Intergenic
1076121711 10:127941489-127941511 TGCTCCTGTGAGCCCACAGCGGG - Intronic
1076266037 10:129110600-129110622 TGCTCCTTGCCTCCACCTGCGGG - Intergenic
1077123975 11:924502-924524 TCCTCCAGGAAGCCCTCTGCTGG + Intergenic
1077168775 11:1157183-1157205 GGCTCCTGGCAGCAGCCTCCAGG - Intergenic
1077269408 11:1668176-1668198 TGCTCCAGGAAGGCGCCTGCGGG - Intergenic
1077284077 11:1758202-1758224 TGCTCCTAACAGTTCCCTGCTGG - Intronic
1077296558 11:1829185-1829207 TGCTCCAGGCATCTCACTGCTGG - Intronic
1077341382 11:2027895-2027917 TGGCCCGGGCCGCCCCCTGCAGG + Intergenic
1077369116 11:2173332-2173354 GGCTCCTCGCTGCCCTCTGCAGG + Intergenic
1077539360 11:3139319-3139341 TGCCCCTGGCAGACCCCAGCAGG - Intronic
1080122928 11:28698099-28698121 TGCTATTTGCTGCCCCCTGCTGG + Intergenic
1084411769 11:69009867-69009889 TGCTCCTGGGAGGCCCATCCCGG - Exonic
1085455005 11:76660672-76660694 TGCCCCTCTCAGCCCCCAGCGGG - Exonic
1088745064 11:112798105-112798127 AGCACCTGACCGCCCCCTGCAGG - Intergenic
1090732450 11:129583433-129583455 GGCTCCTGGACGCCCCTTGCTGG - Intergenic
1090805314 11:130198663-130198685 TGCTCAGGGCAGCCTCCTCCAGG - Intronic
1202824367 11_KI270721v1_random:83084-83106 TGGCCCGGGCCGCCCCCTGCAGG + Intergenic
1091567649 12:1660988-1661010 GCCTCCTGGCAGCCCCATGCGGG + Intergenic
1092013093 12:5132558-5132580 TGCTTCTGCCAGCCTTCTGCAGG + Intergenic
1092263970 12:6967405-6967427 AGTTCCTGGCAGCAGCCTGCAGG - Intronic
1094627350 12:32136526-32136548 TGTTCCCTGCAGCCCCTTGCTGG - Intronic
1095840375 12:46685519-46685541 AGCTCCTGGCAGCCCTATCCTGG - Intergenic
1096535578 12:52270670-52270692 TCCTCCTGGCTGCTCCCAGCTGG + Intronic
1096571277 12:52524658-52524680 TGCTCCCCACAGCCCCCTGCAGG - Intergenic
1096776472 12:53967320-53967342 TGCTCCTGGCGGCTCCCACCCGG - Intergenic
1099361026 12:81702071-81702093 TGCTCCTAGCAGCTGGCTGCTGG + Intronic
1099436161 12:82648027-82648049 TGAACCAGCCAGCCCCCTGCTGG - Intergenic
1100460622 12:94795751-94795773 TGCTGCTGGCAGCCACCAGCAGG - Intergenic
1101387873 12:104273693-104273715 TGCGCGTGGCAGCCTTCTGCAGG + Intronic
1101759328 12:107645973-107645995 GGCCCCTGGGAGCCTCCTGCTGG - Intronic
1102299795 12:111762974-111762996 TGCTCCTGGCTCCCCCATCCTGG + Intronic
1102555637 12:113724843-113724865 TGGTGCTGACAGCCACCTGCTGG - Intergenic
1103937564 12:124484630-124484652 TGCTCCAGGCAGAGCCCAGCAGG - Intronic
1104501984 12:129294746-129294768 TGCTCCCATCACCCCCCTGCAGG + Intronic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1105820719 13:24078576-24078598 TGCTGCTGTCAGCACCATGCTGG - Intronic
1106224470 13:27774625-27774647 TGCACCTGGCAGTCCCTTGGAGG + Intergenic
1106234265 13:27848450-27848472 TGCTCCTGGCTACTTCCTGCAGG - Intergenic
1106503974 13:30355526-30355548 AGCTCCCGGAGGCCCCCTGCTGG - Intergenic
1106815800 13:33405400-33405422 GGCTCCTGGCTTCTCCCTGCAGG - Intergenic
1110136225 13:72070738-72070760 TGGTCCTGGGATCCCCTTGCTGG - Intergenic
1111116120 13:83779897-83779919 TGCTCATGCCAGCCCCCAGAGGG - Intergenic
1111971997 13:94926319-94926341 TGCTCCTGGTACCACACTGCAGG - Intergenic
1112008464 13:95274342-95274364 TGCTCCTGGCTGGGCCCTTCTGG - Intronic
1112092845 13:96100528-96100550 AGCTCCTGTCAGCCACCAGCAGG - Intronic
1112508971 13:99991680-99991702 AGCTCCTGGCAGGCCCTCGCTGG - Intergenic
1112720374 13:102237063-102237085 TGTTCCTGGCAGCCTCCTCTAGG - Intronic
1113647737 13:112011046-112011068 TGCACATGGCAGCCCCTTGCTGG + Intergenic
1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG + Intronic
1113921382 13:113914922-113914944 TGCTCCTGGCTGTGCTCTGCAGG + Intergenic
1113946697 13:114048511-114048533 TGCTCCTGACAGCACCGAGCCGG + Intronic
1114634794 14:24181483-24181505 TGCTGCTGGCAGCCCTCAGAGGG - Intronic
1115687814 14:35814579-35814601 TGCTCCCTGCTGCCCCCTTCTGG + Intergenic
1116020619 14:39455661-39455683 AGCTCCTGCCAGCCCGCTGGGGG + Intergenic
1118821114 14:69346884-69346906 TGCTCCTCACCTCCCCCTGCTGG + Intronic
1119035984 14:71231072-71231094 TGCCCCTGGGAGCCCCCTGGAGG + Intergenic
1119428190 14:74549673-74549695 GGCTCCTGGCAGCCCTCTGCTGG - Intronic
1121315897 14:92960834-92960856 TGGTGCTGGCAGCACCCTCCAGG - Intronic
1122140014 14:99657478-99657500 TGGCCCTGCCAGACCCCTGCTGG + Intronic
1122275227 14:100587488-100587510 TCCTCCCGGCAGCGCCCGGCCGG + Intergenic
1122417689 14:101558184-101558206 TTCCCCTGCCCGCCCCCTGCTGG + Intergenic
1122436666 14:101705845-101705867 TGCTCCCGGAAGCCCCTGGCGGG - Intergenic
1122834009 14:104422181-104422203 TGCCCCTGGCAGTCCTGTGCTGG - Intergenic
1122883322 14:104699753-104699775 TGCTCCTGGCAGCCTGGTGCTGG + Intronic
1122920877 14:104879638-104879660 TGCCTCTGGCCACCCCCTGCTGG - Intronic
1123027970 14:105437536-105437558 TGCTGCTGGCACACACCTGCAGG - Intronic
1123035118 14:105468839-105468861 TGCTCCTGGTCACCCCCAGCTGG - Intronic
1124115429 15:26838607-26838629 TGCACCTGGCAGTCCCCCTCTGG + Intronic
1124212091 15:27771463-27771485 TTCTCCAGGCAGCGCCCAGCTGG + Intronic
1124407223 15:29403924-29403946 TGCCCCTGGCTGGCCGCTGCAGG + Intronic
1125300989 15:38252981-38253003 TGCTGCCGCCACCCCCCTGCGGG + Exonic
1125355983 15:38817879-38817901 TGTGCGTGGCCGCCCCCTGCTGG - Intergenic
1125380753 15:39084206-39084228 TGATGCTGGCAGCCCCAGGCTGG - Intergenic
1127126639 15:55818756-55818778 AGCTCCTGGCAGCCCCAGGATGG - Intergenic
1128539566 15:68517184-68517206 TTCTCCTCCCAGCCTCCTGCGGG + Intergenic
1128795049 15:70460372-70460394 TGCTCCTGCCAGCCACCAGGGGG - Intergenic
1129195687 15:73964901-73964923 TGCTCTTGCCCGCCCCCTGGTGG + Intergenic
1129679539 15:77650470-77650492 GGGTCCAGGCTGCCCCCTGCTGG - Intronic
1132862459 16:2078340-2078362 TCCTCCTGGAAGCCCGTTGCAGG + Intronic
1132909206 16:2299684-2299706 TGCTCCTGGCTGCTCCCCTCCGG + Intronic
1132998788 16:2838802-2838824 TGCTCCTGACAGCCACCTCCAGG + Intronic
1133297047 16:4759370-4759392 TGCTCCAGCCATCCCACTGCTGG + Intronic
1133297852 16:4763885-4763907 TGCTGCTGGCTGCACACTGCTGG - Intronic
1134180369 16:12043050-12043072 TGCTCCTGGCCGACCGCTGCAGG + Exonic
1134207890 16:12252679-12252701 TGGTCCTGGCAGCCCCGTTGCGG + Intronic
1134231806 16:12435712-12435734 TGCTCCTAGAAGGCCCCAGCTGG + Intronic
1134397270 16:13876716-13876738 TACTCATGGAAGCCCCATGCTGG - Intergenic
1135307109 16:21376802-21376824 TGCTCCTGGCCGACCGCTGCAGG + Intergenic
1135436314 16:22428931-22428953 AGCTCCTGGTGGCCTCCTGCTGG + Intronic
1135555802 16:23435611-23435633 GGCTCCTGTCCGCCCCCTTCTGG + Intronic
1135724920 16:24846629-24846651 TGCTGCTGGCTGCCGGCTGCTGG - Intronic
1135764877 16:25168945-25168967 TGCTCCCGCCAGCACCGTGCTGG + Intronic
1136303856 16:29355941-29355963 TGCTCCTGGCCGACCGCTGCAGG + Intergenic
1136372461 16:29844912-29844934 TGCCCATGGCAGGCCACTGCTGG + Intronic
1137566750 16:49538103-49538125 AGCTCCTGACAGCCCCCACCAGG + Intronic
1137686492 16:50390457-50390479 TGCTTCTCACAGCCCCCAGCTGG - Intergenic
1137692388 16:50438035-50438057 TGGTCCTGGCAGCCCCTGGCAGG + Intergenic
1138659088 16:58507368-58507390 TGCTCCTTGGAGCCCCCTTTAGG + Intronic
1139836878 16:69846100-69846122 TGCTGGTGGCAGTCCCATGCTGG - Intronic
1142412210 16:89922677-89922699 CGCTCATGGCAGCCCCTTGGTGG + Intronic
1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496615 17:309584-309606 GGCTCCTGCCAGCCTCCTGCTGG + Intronic
1142496633 17:309638-309660 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496655 17:309697-309719 GGCTCCTGCCAGCCTCCTGCTGG + Intronic
1142744343 17:1948236-1948258 TGGTCCTGGCAGTGCTCTGCAGG + Intronic
1142886936 17:2918724-2918746 TGATCCAGTCAGCTCCCTGCAGG + Intronic
1143498068 17:7323713-7323735 GTCTCCTGGCAGGGCCCTGCGGG - Exonic
1144614581 17:16757403-16757425 TGCTCCTGGATGCCACGTGCAGG + Intronic
1144671685 17:17136404-17136426 TCCTGCTGCCAGCTCCCTGCGGG + Exonic
1144783612 17:17820037-17820059 TGCTCCTGGAAGCCCCACCCCGG + Intronic
1145799937 17:27676504-27676526 CTCTCTTGCCAGCCCCCTGCAGG + Intergenic
1146306472 17:31733459-31733481 TGGTCCTGGCAGGCCCCTTGTGG - Intergenic
1146659949 17:34659036-34659058 TGTTCCTGGCAGTCCCCACCTGG - Intergenic
1146794298 17:35770297-35770319 TGCGCCAGGGCGCCCCCTGCAGG + Exonic
1147211548 17:38875125-38875147 TTTTCCTGGCAGGCCCCTGTGGG + Intronic
1147538225 17:41334754-41334776 TTCTCCTGCCAGCCCCCCACAGG + Intergenic
1147678103 17:42221039-42221061 AGCTCCTGGCTGGCCCCTGAGGG + Intronic
1147687846 17:42297899-42297921 AGCTCCTGGCTGGCCCCTGAGGG - Intronic
1147882461 17:43662896-43662918 TCCTCATGGCTGCGCCCTGCTGG + Intergenic
1148700202 17:49582418-49582440 GGCCCCCGGCAGCCCCCAGCTGG - Intronic
1149007307 17:51819510-51819532 AGCTCTTGGCAGAGCCCTGCAGG + Intronic
1150446577 17:65231257-65231279 TGCTCTTGGGATCCCCCTACTGG + Intergenic
1151159438 17:72152456-72152478 TACTCCAGGCAGCCCCGTTCTGG + Intergenic
1152445311 17:80339379-80339401 AGCTGCTGGCAGCCCTCTGCAGG + Exonic
1152525094 17:80884001-80884023 TCCTCCTGGCTGCCGACTGCGGG + Intronic
1152845924 17:82599771-82599793 TCCTACTCGCAGTCCCCTGCAGG - Intronic
1153895068 18:9551404-9551426 TGCTCCTGCCAGCCACCATCTGG - Intronic
1156379751 18:36547193-36547215 AGCTCCTGGCAGCACCAGGCCGG + Intronic
1157481891 18:48060481-48060503 TCCTCCTGCCTGCCTCCTGCTGG + Intronic
1158327479 18:56326832-56326854 TTCTTGTGGCATCCCCCTGCAGG + Intergenic
1160431618 18:78816976-78816998 TGCTCCGGGCTCCCCGCTGCGGG + Intergenic
1160431662 18:78817093-78817115 TGCTCCGGGCTCCCCGCTGCGGG + Intergenic
1160953618 19:1679424-1679446 TGCTCCTGGCAGGGACGTGCAGG - Intergenic
1160981355 19:1818016-1818038 TGCCCCGGGCAGCACCCTCCAGG + Intronic
1162441060 19:10692257-10692279 TGCACCTGTGAGCCCCATGCTGG + Exonic
1162975186 19:14204340-14204362 TTCTCCTGTCTGCCCCCGGCAGG - Intronic
1163138506 19:15331496-15331518 TCAGCCTGGCAGCCCCTTGCTGG - Intronic
1163311353 19:16516823-16516845 TGCTCATTGCAGCCCTCTGGGGG + Intronic
1163363641 19:16863925-16863947 AGCTCCTGGAAGCTTCCTGCCGG + Intronic
1163470891 19:17496427-17496449 TGCTCATGGGCTCCCCCTGCAGG - Intronic
1163495928 19:17646660-17646682 TGCTCGTTGGTGCCCCCTGCAGG + Intronic
1163529066 19:17839092-17839114 TGCTCATTAAAGCCCCCTGCAGG - Intronic
1163546964 19:17946475-17946497 TGCTCGTTGGTGCCCCCTGCAGG - Intergenic
1163630042 19:18413630-18413652 TGCTCCTGGGCACCCCCTGCAGG - Intergenic
1163719120 19:18890005-18890027 TCCTGCTGTCAGCCCCCTCCTGG + Intronic
1163757672 19:19116169-19116191 TGCTCATTGGTGCCCCCTGCAGG + Intergenic
1164559425 19:29278922-29278944 AGCTCTTGTCAGCCCGCTGCTGG - Intergenic
1164658537 19:29942317-29942339 TGCTACTCGGAGCCCGCTGCGGG + Exonic
1166359562 19:42247525-42247547 TGCTCGGTGCAGCCCCCTGAGGG - Intronic
1166951825 19:46433861-46433883 TGATCCTGCCATCCCACTGCTGG - Intergenic
1167684848 19:50949860-50949882 TGCTCACGGCCGCCCACTGCAGG - Exonic
1168249886 19:55135874-55135896 GGCTCCTGGAAGCCCTCTGGGGG - Intronic
925281395 2:2687845-2687867 GGGTCCTGGCAGTCCCCTCCTGG + Intergenic
925552954 2:5095875-5095897 TTCTCCCGGCAGCTCCCAGCCGG - Intergenic
925982809 2:9191002-9191024 TGCTTCTGCCAGCCCCAGGCTGG + Intergenic
926053417 2:9759058-9759080 TGCTCCTGGCAGGGCAATGCAGG + Intergenic
926103713 2:10137307-10137329 GGCACCTGCCAGCCCCATGCTGG + Intergenic
926243183 2:11103590-11103612 TACGCCAGGCAGCCCCCTCCAGG + Intergenic
926683696 2:15681994-15682016 GACTCCTGGCAGCCCAGTGCAGG + Intergenic
927712822 2:25336300-25336322 TGGCACTGGCAGCCCCTTGCAGG + Intronic
927868037 2:26605412-26605434 TCCTCCGGGCAGCCACTTGCAGG - Intronic
929079248 2:38106151-38106173 AGCTCCTCACAGCCGCCTGCGGG - Intronic
930073970 2:47391726-47391748 GGCTCCTTTCAGCCCACTGCTGG + Intergenic
932321736 2:70827458-70827480 GGCTCCAGGTAGCCCCCAGCAGG - Intergenic
933553777 2:83807474-83807496 TGCTCCTGACACCCACCTGAGGG + Intergenic
934976383 2:98805721-98805743 TGGCCCTGGCAGCCCCATGCTGG - Intronic
935184903 2:100723220-100723242 GGTTGCTGGCAGCCCTCTGCTGG - Intergenic
937227741 2:120379339-120379361 TGCTTCAGGCAGCCCCCAACAGG + Intergenic
937472154 2:122183476-122183498 TGCTCCTGGGCACCGCCTGCAGG + Intergenic
937976278 2:127583833-127583855 AGCTTCTCACAGCCCCCTGCCGG - Intronic
938000679 2:127733285-127733307 GACTCCTGTCAGTCCCCTGCAGG - Intronic
938754612 2:134368266-134368288 TGCTCCTGGCTGCCCACCGCAGG + Intronic
939828541 2:147045230-147045252 AGCTCCTTGCTGCCCCCTCCTGG - Intergenic
939957380 2:148538320-148538342 AGCTCATGGCAGCTCCATGCTGG + Intergenic
940346929 2:152637889-152637911 AGCTCTTGGCAGCCCCCTTGGGG + Intronic
942926093 2:181434164-181434186 TCCTCCTGGCAGCCATCTGGAGG + Intergenic
944563306 2:200963308-200963330 TGCGCCTCGCTGCCCCCCGCAGG - Intronic
945335286 2:208584689-208584711 TGCTCCTGCAAGAGCCCTGCAGG - Intronic
945932087 2:215865468-215865490 TTCTCCTGGCAGCAGCCAGCTGG - Intergenic
946161332 2:217837812-217837834 TGCTCCTGGCAGCCCCTGGCTGG - Intronic
947925228 2:233915340-233915362 TGCTCAGGGCAGCCACCTTCTGG + Intergenic
948575879 2:238949393-238949415 TCCCCCTGGAAGCCACCTGCAGG + Intergenic
948639022 2:239361432-239361454 TTCTCATGGCAGCCCTCTGCAGG - Intronic
948757721 2:240169001-240169023 TGGTCCTGGCACCCCCCGTCAGG + Intergenic
948949671 2:241240804-241240826 TGCTTCTGGCAGACCCACGCAGG + Intronic
1169504024 20:6189074-6189096 TGCTCCTGTCAGCCACCACCAGG - Intergenic
1170816490 20:19719052-19719074 GGGTCCTGGAAGCCACCTGCTGG + Intronic
1171472193 20:25381066-25381088 TGACCCTGGCAGCCCCTAGCCGG + Intronic
1171881770 20:30622471-30622493 TGCTCCTGGCACACCCCTGCAGG - Intergenic
1172284578 20:33731917-33731939 GGCTCCTGGGCGCCCCCTGGCGG + Exonic
1172502320 20:35436329-35436351 GCCCCCTGGCAGCCCCCTCCAGG + Intronic
1172762545 20:37332532-37332554 TGCTCCTGCTTGCCCTCTGCTGG - Intergenic
1172913626 20:38428217-38428239 CGCCCCAGGCAGCTCCCTGCAGG + Intergenic
1172969138 20:38860908-38860930 TGCTCCCAGGGGCCCCCTGCAGG + Intronic
1172979897 20:38933080-38933102 TGCTCATGTCAGCCCCAAGCAGG + Intronic
1175764787 20:61584791-61584813 CGCAGCTGTCAGCCCCCTGCAGG - Intronic
1175901024 20:62359982-62360004 GGCTGCTGGCAGCCCGCTGCAGG + Intronic
1176138185 20:63534155-63534177 TGCGGCTGGCCGCGCCCTGCCGG - Exonic
1180227176 21:46401351-46401373 TGCACCAGGCAGGCCTCTGCTGG + Intronic
1181055657 22:20259482-20259504 AGCTGCAGGCAGCCTCCTGCTGG + Intronic
1181684619 22:24519924-24519946 TTCTCCTGGAACCCACCTGCTGG - Intronic
1183331373 22:37223791-37223813 TGCTCCTGGAACTTCCCTGCAGG - Intergenic
1183381833 22:37494109-37494131 TGATCCGGGGAGTCCCCTGCAGG + Exonic
1183493578 22:38129321-38129343 TGCTCCTGGCAGCTCTGAGCAGG + Intronic
1183582340 22:38733440-38733462 GGATCCAGTCAGCCCCCTGCTGG - Exonic
1183672731 22:39282748-39282770 TCCTCTTGGCAGGGCCCTGCAGG + Intergenic
1184041988 22:41949747-41949769 TGCTCCTGGCTGCTCCCCGATGG - Intergenic
1184115080 22:42417567-42417589 TGCTCCTTGCAGCCACCTCCAGG - Intronic
1184259764 22:43307940-43307962 TCTTCCTGCCAGCCCCCTTCTGG - Intronic
1184538520 22:45104002-45104024 TGCGGCTGGCAGGCCACTGCTGG - Intergenic
1184566303 22:45294069-45294091 TGCTCCAGGCAGCACCCCCCCGG - Intronic
1184838345 22:47037220-47037242 GGCTCCTGGCACCCCCATGGCGG - Intronic
1184869030 22:47221906-47221928 TGCTCCTGGGGGCTCCCTCCTGG - Intergenic
1185068349 22:48643089-48643111 GGCTCCAGGCATCCACCTGCTGG + Intronic
949336217 3:2978378-2978400 TGTTCCTACCAGGCCCCTGCAGG - Intronic
950124802 3:10504707-10504729 GGCTCCTCCCTGCCCCCTGCAGG - Intronic
952828492 3:37543851-37543873 TGGTCTGGGCAGGCCCCTGCAGG - Intronic
953627111 3:44580324-44580346 TCCTGCTGCCAGCTCCCTGCGGG - Intronic
954081815 3:48216676-48216698 TTCTCCAGTCAGCTCCCTGCTGG + Intergenic
954108652 3:48422387-48422409 TGCTCACTGCAGACCCCTGCTGG + Exonic
954633866 3:52061086-52061108 AGGGCCTGGCAGGCCCCTGCTGG - Intergenic
954715255 3:52523720-52523742 TGCTCTGGCCAGCCCCCTCCTGG + Exonic
956210580 3:66798056-66798078 TGCTCCTGGGAGCCCTGTGAGGG + Intergenic
957934532 3:86925519-86925541 TCATCCTGGCAGACCCCTCCTGG - Intergenic
961255456 3:125546813-125546835 GGCTCCTTGCAGCCGCCTCCTGG - Intronic
961371427 3:126434135-126434157 TCCGCCTGCCAGCACCCTGCTGG + Intronic
961514867 3:127426253-127426275 TGCTCCTGGAGCCACCCTGCTGG - Intergenic
962313063 3:134339486-134339508 TGCACCTGCCGACCCCCTGCAGG + Intergenic
964771084 3:160225297-160225319 TGCCCATGGCAGCCCCGCGCGGG + Intergenic
966807631 3:183819230-183819252 TCCTCCTGGCACCCCAGTGCTGG - Intronic
967879950 3:194294733-194294755 TGCTTCAGGCAGCAGCCTGCTGG - Intergenic
967884781 3:194325915-194325937 TGCTCCTGCAAGCCCCCCACCGG + Intergenic
968001330 3:195208859-195208881 TCCTCTTGCAAGCCCCCTGCTGG - Intronic
968544596 4:1192312-1192334 TGGTCTTGGCAGCCCTGTGCTGG + Intronic
968621190 4:1604159-1604181 TGCACCAGGCAGCCCCTTCCCGG - Intergenic
969582105 4:8071587-8071609 TGCCCCTGGCTTCCCTCTGCAGG - Intronic
969663711 4:8545040-8545062 TGGTCCTGGCAGCCCCAGGTCGG + Intergenic
970435882 4:16034824-16034846 GGGACCTGGAAGCCCCCTGCTGG - Intronic
975395503 4:73869538-73869560 TGCTCCTGGTAGCCGCTGGCCGG + Exonic
975401492 4:73944244-73944266 TGCTCCTGGTAGCCTCCGGCCGG - Intergenic
975409991 4:74038522-74038544 TGCTCCTGGTGGCCGCCAGCCGG - Exonic
975415379 4:74099031-74099053 TGCTCCTGGTGGCCGCCAGCCGG - Exonic
978545962 4:109873026-109873048 TGCTGCTGGCAGCACCCAGCAGG - Intergenic
979408765 4:120347516-120347538 GTCTCCTAGCAGCCCCTTGCAGG - Intergenic
981746165 4:148054436-148054458 AGCTCGAGGCAGCCACCTGCTGG + Intronic
982436035 4:155383954-155383976 TGCTCCTGCCAGCCCCCCACAGG - Intergenic
982636172 4:157899586-157899608 TGACCCTGGCTGCCCCATGCAGG - Intergenic
984584146 4:181543608-181543630 TTCTACTGCCAGCCACCTGCTGG + Intergenic
985774125 5:1831802-1831824 TCCTCCTGCCAGCTCCTTGCTGG + Intergenic
985893210 5:2732440-2732462 TCCTACTGGCAGCTCCCTGTGGG - Intergenic
986336339 5:6758601-6758623 TGCTCCTGGAAGCCTCCTAAAGG - Intergenic
986687827 5:10289567-10289589 TCCTCCTGGCAGCCCCTTGAGGG - Intronic
996265554 5:121535203-121535225 TTCTGCAGGCAGTCCCCTGCAGG + Intergenic
998184582 5:139968558-139968580 TCCTCCTTCCAGTCCCCTGCAGG - Intronic
998386622 5:141760768-141760790 TGCCCCGGGCAGCCGCCTGGTGG - Intergenic
999261144 5:150239631-150239653 TGCTCCTGCCTCCCTCCTGCAGG - Intronic
999288553 5:150408524-150408546 TACTCCTGCCCACCCCCTGCAGG - Intronic
1001240817 5:170068634-170068656 TGACCCTGGCAGCCCCTTTCTGG - Intronic
1001751911 5:174137679-174137701 TGCTCCAGGCAGCCCCAGGAAGG - Intronic
1001933423 5:175688566-175688588 TGTTTCTGGGAGTCCCCTGCTGG - Intergenic
1002401925 5:178995772-178995794 TTCTCCTTGCAGAACCCTGCAGG + Intronic
1002422417 5:179155516-179155538 CGCACCAGCCAGCCCCCTGCTGG - Intronic
1003248061 6:4400899-4400921 TGCTCCTGGGAGAGCCCTGAAGG + Intergenic
1003607756 6:7580126-7580148 TGGTCTTGGCAGCCTCCTCCAGG - Exonic
1004207003 6:13600875-13600897 CGCCCCTGGCAGCCACCTGGGGG - Exonic
1004662813 6:17725350-17725372 TGCTCCTGGCTGAGCCCTGGGGG + Intergenic
1006193285 6:32222468-32222490 TGCTCCTGCCTGTCCCCTCCTGG + Intronic
1006386425 6:33733569-33733591 TGATCCTGCCACCCCTCTGCTGG + Intronic
1006393336 6:33771673-33771695 GGCTGCAGGCTGCCCCCTGCCGG - Exonic
1006620653 6:35361647-35361669 TGCTCCTGCCAGCCCCTGCCTGG + Intronic
1006815854 6:36849356-36849378 TGCTGCTGACAGCCCCTTGGAGG + Intergenic
1006897313 6:37479402-37479424 TGGGGATGGCAGCCCCCTGCAGG + Intronic
1007301213 6:40869311-40869333 CCCTCCTGGCTGCCCCCAGCTGG - Intergenic
1007917521 6:45575012-45575034 TGCACCTGGCACACCCCAGCTGG - Intronic
1008539149 6:52531515-52531537 TGCTCCTGGAATCCTCCTCCAGG - Intronic
1011015118 6:82746029-82746051 TGCATCTGGAAGCCCCGTGCCGG - Intergenic
1012382185 6:98633498-98633520 TGCACCTGGCAGCCCACTATAGG - Intergenic
1015965387 6:138692398-138692420 TGCTCCCGCCCGCCCCCTGGCGG - Intronic
1018446869 6:163866363-163866385 TGCTTCTGCCTGCCTCCTGCTGG + Intergenic
1018727125 6:166621771-166621793 CTCTCCTGGCAGCTCCCTGAAGG + Intronic
1019143041 6:169960223-169960245 TGCTCCTGCCAGCCCCTGGGAGG - Intergenic
1019473482 7:1233235-1233257 CGCTGCTGCCAGCCGCCTGCGGG + Exonic
1019514265 7:1432881-1432903 TGCACCTGGAAGGTCCCTGCCGG + Intronic
1019598593 7:1869931-1869953 TGCTCCAGCCAGCCGCCTGTTGG - Intronic
1019698318 7:2460243-2460265 GGCTCCTGGCAGCCCCAGGAAGG - Intergenic
1019701804 7:2477789-2477811 TGCCCAGGGCTGCCCCCTGCAGG - Intergenic
1020013427 7:4818261-4818283 TGCTCCTGGGAGGCCCGCGCTGG - Intronic
1021612875 7:22475210-22475232 GGCACCTGGCATCTCCCTGCTGG + Intronic
1021880773 7:25093497-25093519 AGCTCTTGGGGGCCCCCTGCTGG + Intergenic
1022104580 7:27188983-27189005 AGGTCCAGGCAGCCCTCTGCAGG + Intergenic
1022335363 7:29416908-29416930 AGCTCCTTGCTGGCCCCTGCAGG + Intronic
1022975962 7:35557264-35557286 TCCTCCTGTCACCCGCCTGCAGG + Intergenic
1023287788 7:38637087-38637109 TGCTGCTGGGAGCCGCCTCCAGG + Intergenic
1023867346 7:44244474-44244496 GGCCCCAGGGAGCCCCCTGCTGG - Intronic
1024051730 7:45628000-45628022 TGCCCCTGGCAGGCTCCTGGTGG + Intronic
1024226489 7:47329756-47329778 TGGGCCTGGCTGCCCCATGCTGG - Intronic
1024232523 7:47373507-47373529 TGTTCCTAGCAGTCCACTGCAGG + Intronic
1024263219 7:47587274-47587296 AGCTCTTGGCAGCCTCCTGTGGG - Intergenic
1024763499 7:52629099-52629121 TGGCAATGGCAGCCCCCTGCAGG - Intergenic
1026869465 7:73841804-73841826 TCCTCCAGGCAGCCCCCCTCAGG + Intronic
1026971868 7:74473353-74473375 AGCTCTTGGCAGCCCCAGGCTGG - Intronic
1027151010 7:75733644-75733666 TACTCCTGCCAGCCTCCTCCAGG - Intronic
1027185514 7:75968553-75968575 TGCTTCTTGGAGCCCCCAGCAGG + Intronic
1029885237 7:103862791-103862813 TGCTCCTGTCACCCAACTGCTGG - Intronic
1030013044 7:105190075-105190097 TGCTCCTGGCCTGCTCCTGCTGG - Intronic
1031815397 7:126427761-126427783 TGTTCCTTGCAGCCCCTAGCAGG + Intergenic
1032992684 7:137411233-137411255 TGCCCCTGCAAACCCCCTGCTGG - Intronic
1033308061 7:140239335-140239357 TGGGCCAGGCAGCCCCCTTCAGG - Intergenic
1034499345 7:151439950-151439972 TACACCGGGCAGCGCCCTGCTGG + Exonic
1035427637 7:158791250-158791272 TGCTCCAGGCCGCCACATGCTGG - Intronic
1035573528 8:689533-689555 TGCTCCTGCCAGACACCTCCAGG - Intronic
1036455718 8:8905385-8905407 GGCTCCTGACAGCCCACTACTGG - Intergenic
1036646387 8:10613215-10613237 TGCTCCTGGCAGGCACCCTCAGG - Exonic
1037813094 8:22098166-22098188 TGCTCCTGCCAGGCCCCAGCTGG + Exonic
1037865567 8:22440358-22440380 TGCTCCTGGGACCCCCGGGCCGG - Intergenic
1038022520 8:23562196-23562218 GGCTCCAGGCAGCGCCCTTCAGG - Intronic
1039840043 8:41286551-41286573 TGCTCCTTGCTGCCAACTGCAGG + Intronic
1040598944 8:48865541-48865563 TGGTCCTGGCAGCACCCTGGTGG + Intergenic
1041027619 8:53703345-53703367 TGCTCCTTGAATGCCCCTGCTGG - Intergenic
1048901002 8:139037851-139037873 TGCTCTCTGCTGCCCCCTGCGGG - Intergenic
1049276637 8:141723395-141723417 TGCCCCAGGCAGCCCCAAGCAGG + Intergenic
1049608606 8:143541503-143541525 TGCTCCTGGCAGCTCCGCCCTGG - Intergenic
1049799163 8:144509836-144509858 TGCTCCTGGCTGCCACCTACTGG + Exonic
1053466953 9:38315786-38315808 TGCTCCTTGGAGGCCCCTGGGGG - Intergenic
1055597907 9:77884237-77884259 TGCTTCTGGCAAGCCCCTGTGGG + Intronic
1056273180 9:84967311-84967333 TGGTCTAGGCAGACCCCTGCTGG + Intronic
1056991904 9:91421212-91421234 TGCCCCTGTCTGCCCCGTGCGGG + Intronic
1057076444 9:92140695-92140717 TGCTCCTGGTTGCCCACTGCCGG + Intergenic
1057147130 9:92765502-92765524 GGCCCCTGGGCGCCCCCTGCTGG - Intergenic
1057442920 9:95095041-95095063 TGTTCCTGGCAGCACTCTCCTGG - Intergenic
1059295876 9:113270122-113270144 TACTCCTTCCAGCCCCCAGCTGG - Intronic
1059414630 9:114155425-114155447 TGCCCCCTGCTGCCCCCTGCCGG - Intergenic
1059745222 9:117193807-117193829 TGCTCCTGGCAGCACCCTCAAGG + Intronic
1059761855 9:117345120-117345142 GGCTCCTGGCAGTCCTCTCCTGG - Intronic
1060794237 9:126503740-126503762 TGTTCCTGGCAGCCCTGGGCCGG - Exonic
1061015892 9:127980690-127980712 AGCTCCTGGCAGCCCCCTGGGGG - Intergenic
1061048981 9:128183031-128183053 TGCACCAGGGAGTCCCCTGCAGG + Intronic
1061136933 9:128740109-128740131 TTCTCCTGGCAGCAACCTGTTGG - Exonic
1061192368 9:129089245-129089267 TGCTGCTGCCAGCCCCTGGCTGG + Exonic
1061278430 9:129583178-129583200 TCCACCTGTCAGGCCCCTGCAGG - Intergenic
1061422160 9:130478329-130478351 GGCTCCTGGGAGCCCTGTGCAGG - Intronic
1061746264 9:132742573-132742595 TGCCCCTCGCAGCCCTCTGAGGG + Intronic
1061800183 9:133109396-133109418 GGCTCGGGGCAGCCCCCGGCGGG - Intronic
1062161881 9:135085113-135085135 TCCTCATGCCAGCCCCCTACAGG - Intronic
1062167411 9:135114824-135114846 TGGTGCTGGCAGCTCCCTCCTGG - Intronic
1062171531 9:135137458-135137480 TGCTCCTGTGGGCTCCCTGCAGG - Intergenic
1062368592 9:136224437-136224459 TGCTCCTCGCCGCGCCCTGGGGG - Intronic
1062493722 9:136821862-136821884 GCCTCCTGGCTGCCCCCAGCCGG + Intronic
1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG + Intronic
1185449890 X:276350-276372 AGCTCCTGGCAGCTCCCGCCGGG - Intronic
1188033243 X:25288136-25288158 TCTTCCTGGCAGCCAACTGCAGG - Intergenic
1196053411 X:111329758-111329780 TGCTCCTGGCAGTCTGATGCAGG + Intronic
1196921698 X:120591838-120591860 GGCTACTGCCAGACCCCTGCTGG - Intergenic
1197262538 X:124333731-124333753 TCCTCCTGGAAGCCCACTGCAGG - Intronic
1199851237 X:151726168-151726190 CCCTCCTAGCAGCCCCCTGAGGG + Intergenic