ID: 1062497969

View in Genome Browser
Species Human (GRCh38)
Location 9:136840511-136840533
Sequence GAGGAGCTCTAGGCCGGCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 334}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062497961_1062497969 2 Left 1062497961 9:136840486-136840508 CCGCCACCCTGGGGGTGGCGACT 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1062497969 9:136840511-136840533 GAGGAGCTCTAGGCCGGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 334
1062497962_1062497969 -1 Left 1062497962 9:136840489-136840511 CCACCCTGGGGGTGGCGACTACG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1062497969 9:136840511-136840533 GAGGAGCTCTAGGCCGGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 334
1062497951_1062497969 26 Left 1062497951 9:136840462-136840484 CCTGGGGGGCGGGGCCCCGGGCG 0: 1
1: 0
2: 11
3: 77
4: 650
Right 1062497969 9:136840511-136840533 GAGGAGCTCTAGGCCGGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 334
1062497956_1062497969 11 Left 1062497956 9:136840477-136840499 CCCGGGCGGCCGCCACCCTGGGG 0: 1
1: 0
2: 2
3: 30
4: 330
Right 1062497969 9:136840511-136840533 GAGGAGCTCTAGGCCGGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 334
1062497958_1062497969 10 Left 1062497958 9:136840478-136840500 CCGGGCGGCCGCCACCCTGGGGG 0: 1
1: 1
2: 0
3: 28
4: 278
Right 1062497969 9:136840511-136840533 GAGGAGCTCTAGGCCGGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 334
1062497954_1062497969 12 Left 1062497954 9:136840476-136840498 CCCCGGGCGGCCGCCACCCTGGG 0: 1
1: 0
2: 3
3: 17
4: 231
Right 1062497969 9:136840511-136840533 GAGGAGCTCTAGGCCGGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 334
1062497963_1062497969 -4 Left 1062497963 9:136840492-136840514 CCCTGGGGGTGGCGACTACGAGG 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1062497969 9:136840511-136840533 GAGGAGCTCTAGGCCGGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 334
1062497965_1062497969 -5 Left 1062497965 9:136840493-136840515 CCTGGGGGTGGCGACTACGAGGA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1062497969 9:136840511-136840533 GAGGAGCTCTAGGCCGGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062497969 Original CRISPR GAGGAGCTCTAGGCCGGCGT GGG Exonic
900106569 1:983989-984011 GAGGAGGTCTAGGGTGGCGGAGG + Intergenic
900140386 1:1137232-1137254 GCGGGGGTCGAGGCCGGCGTGGG + Intergenic
901797790 1:11690875-11690897 GAGAAGCTTCAGGCCGGCTTTGG + Intronic
901855361 1:12041111-12041133 CAGGAGCTCGAGACCGGCTTGGG + Intergenic
904692337 1:32302961-32302983 TAGGAGTTCTAGGCCAGCCTGGG + Intronic
905615887 1:39398345-39398367 CAGGAGTTCAAGGCCGGCCTTGG - Intronic
906222280 1:44090259-44090281 GAGGAGTTCTAGACCAGCCTGGG + Intergenic
906494587 1:46295267-46295289 CAGGAGCTCAAGGCCAGCCTGGG - Intronic
907436746 1:54454555-54454577 GAGGAGTTCTAGACCAGCCTGGG - Intergenic
907466974 1:54644708-54644730 CAGGAGCTCTAGACCAGCCTGGG - Intronic
909646373 1:77921699-77921721 CAGGAGCTCAAGGCCAGCCTGGG + Intronic
910933444 1:92465220-92465242 CAGGAGCTCCAGGCCAGCCTGGG + Intergenic
912167474 1:107057508-107057530 CAGGAGCTGGAGGCCGGAGTGGG + Exonic
914675412 1:149904185-149904207 GAGGAGCCCTAGGCCAGCCTGGG - Exonic
915292862 1:154897934-154897956 CAGGAGCTCGAGGCCAGCCTGGG + Intergenic
915473994 1:156141794-156141816 CAGGAGTTCTAGGCCAGCCTGGG + Intergenic
916195692 1:162220138-162220160 CAGGAGCTCGAGGCCAGCCTGGG - Intronic
920179933 1:204126310-204126332 GAGGAGCTGTTGGCCTGGGTGGG + Exonic
921191630 1:212714094-212714116 CAGGAGCTCTAGACCAGCCTGGG + Intergenic
921303409 1:213771927-213771949 GAGGATATCTGGGCGGGCGTGGG + Intergenic
922313879 1:224423538-224423560 GAGGAGTTCAAGGCCAGCCTGGG + Intronic
922669579 1:227498839-227498861 GAGGAGCACTAGGCCAAAGTTGG + Intergenic
922670014 1:227502463-227502485 GAGGAGCACTAGGCCAAAGTTGG - Intergenic
923055817 1:230425651-230425673 GAGGAGGACGAGGCCGGCGCGGG - Intronic
923847528 1:237752356-237752378 CAGGAGCTCTAGACCAGCCTGGG - Intronic
924242341 1:242053352-242053374 GAGGAGCACTAGGCTGAAGTTGG - Intergenic
1062932355 10:1361581-1361603 GTTGAACTCTTGGCCGGCGTGGG - Intronic
1063710584 10:8473954-8473976 CAGGAGTTCTAGGCCAGCCTGGG - Intergenic
1065192182 10:23222872-23222894 CAGGAGCTCTAGACCAGCCTGGG - Intronic
1065517046 10:26534250-26534272 CAGGAGCTCAAGGCCAGCCTGGG + Intronic
1065793190 10:29280520-29280542 GAGGAGCTCAAGGCTGGAGGTGG + Intergenic
1065922244 10:30403024-30403046 GAGGAGTTCAAGGCCAGCCTGGG - Intergenic
1065926029 10:30434340-30434362 CTGGAGCGCTCGGCCGGCGTGGG + Exonic
1067568013 10:47351993-47352015 GTGGAGCTCTCGGCCAGCGTGGG - Intronic
1071167631 10:82824918-82824940 CAGGAGCTCAAGGCCAGCCTGGG - Intronic
1071285100 10:84137273-84137295 CAGGAGCTTAAGGCCGGCCTGGG - Intergenic
1071580751 10:86767468-86767490 TAGGAGCTCTAGACCAGCCTGGG + Intronic
1072748195 10:97957022-97957044 CAGGAGCTCAAGGCCAGCCTGGG - Intronic
1074530988 10:114298638-114298660 CAGGAGCTCTAGACCAGCCTGGG + Intronic
1074846545 10:117403955-117403977 CAGGAGCTCGAGGCCAGCCTGGG - Intergenic
1076846131 10:133070347-133070369 CAGGAGTTCTAGGCCAGCCTGGG - Intergenic
1080522521 11:33079889-33079911 CAGGAACTCTAGACCGGCCTGGG + Intronic
1082030844 11:47602346-47602368 TAGGAGTTCAAGGCAGGCGTGGG - Intergenic
1084984932 11:72860634-72860656 CAGGAGTTCTAGACCAGCGTGGG + Intronic
1087200825 11:95342741-95342763 CAGGAGATCTAGGCCAGCCTGGG - Intergenic
1090060995 11:123464092-123464114 GAGGAGCTCAAGACCAGCCTGGG + Intergenic
1090201365 11:124860028-124860050 GAGGAGCTCAAGACCAGCCTGGG + Intergenic
1091481653 12:838622-838644 GAGGAGTTCTAGACCAGCCTGGG - Intronic
1091572314 12:1698428-1698450 CAGGAGTTCAAGGCCGGCCTGGG - Intronic
1091749975 12:3016234-3016256 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
1094615253 12:32030421-32030443 CAGGAGTTCGAGACCGGCGTGGG + Intergenic
1095102285 12:38197621-38197643 GAGGAGCACTAGGCTGAAGTTGG - Intergenic
1095528174 12:43152917-43152939 CAGGAGCTCAAGACCGGCCTGGG - Intergenic
1095751116 12:45712538-45712560 CAGGAGTTCAAGGCCAGCGTGGG - Intergenic
1096107620 12:49006327-49006349 CAGGAGCTCGAGGCCAGCCTGGG + Intronic
1097019843 12:56012612-56012634 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
1097093824 12:56529342-56529364 CAGGAGCTCTAGACCAGCCTGGG + Intronic
1097676822 12:62611923-62611945 CAGGAGCTCAAGACCAGCGTGGG - Intergenic
1098000681 12:65938870-65938892 TAGGAGTTCGAGGCCGGCATGGG - Intronic
1098259383 12:68652604-68652626 GAGGAGTTCAAGGCCAGCCTGGG + Intronic
1098357787 12:69627450-69627472 GAGGAGCGCTAGGCCAGGCTGGG + Intergenic
1098535665 12:71591487-71591509 CAGGAGCTCGAGACCAGCGTGGG - Intergenic
1098618523 12:72560611-72560633 CAGGAGCTCAAGGCCAGCATGGG + Intronic
1098626583 12:72678449-72678471 CAGGAGCTCTAGACCAGCATGGG + Intergenic
1098678366 12:73319404-73319426 CAGGAGCTCGAGGCCAGCCTGGG - Intergenic
1099200557 12:79671857-79671879 CAGGAGCTCAAAGCCAGCGTGGG + Intronic
1099207834 12:79748476-79748498 CAGGAGTTCAAGGCCGGCCTGGG + Intergenic
1100193604 12:92219375-92219397 CAGGAGTTCAAGGCCAGCGTGGG - Intergenic
1100315587 12:93441825-93441847 GAAGAGCTGGAGGCCGGCCTGGG + Intronic
1100473885 12:94917934-94917956 TAGGAGTTCTAGGCCAGCCTAGG + Intronic
1101433033 12:104642606-104642628 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
1102646173 12:114405366-114405388 GGGGAGCTCTGGGCTGGCGGAGG + Intronic
1103436726 12:120932501-120932523 GAGGAGTTCAAGGCCAGCCTGGG + Intergenic
1103580262 12:121909527-121909549 CAGGAGTTCTAGACCGGCCTAGG - Intronic
1106068347 13:26380687-26380709 CAGGAGCTCAAGGCCAGCCTGGG - Intronic
1106583387 13:31036599-31036621 AAGGAGCTCTGGGCCCGGGTGGG - Intergenic
1107255140 13:38417123-38417145 CAGGAGATCTAGGCCAGCCTGGG - Intergenic
1107954185 13:45494732-45494754 CAGGAGCTCAAGACCGGCCTGGG - Intronic
1108383057 13:49872575-49872597 GAGGAGCTCCAGACCAGCCTGGG + Intergenic
1110563636 13:76936175-76936197 TAGGAGCTCTAGACCAGCCTGGG - Intergenic
1111879626 13:93939656-93939678 GAGGAGCTCAAGACCAGCCTGGG - Intronic
1114315058 14:21502230-21502252 GAGGAGTTCAAGACCGGCCTGGG - Intronic
1116001763 14:39250356-39250378 TAGGAGTTCGAGGCCGGCCTGGG + Intronic
1116411136 14:44625478-44625500 GAGGAGTTCTAGGCTGTGGTGGG - Intergenic
1116846760 14:49871682-49871704 GAGGAGTTCCAGGCCGGCCTGGG + Intergenic
1117413702 14:55474265-55474287 TAGGAGTTCTAGGCCAGCTTGGG + Intergenic
1118409656 14:65465378-65465400 TAGGAGCTCTAGACCAGCCTGGG - Intronic
1118855928 14:69622374-69622396 CAGGAGCTCAAGACCGGCCTGGG - Intronic
1119415042 14:74464288-74464310 GAGGAGCCCTAAGCCAGCATGGG - Intergenic
1119823680 14:77640026-77640048 CAGGAGCTCGAGACCAGCGTGGG + Intergenic
1120474183 14:84966844-84966866 CAGGAGTTCTAGGCCAGCCTGGG + Intergenic
1120680147 14:87471367-87471389 GAGGAGTTCAAGGCCAGCCTGGG - Intergenic
1121070518 14:91016282-91016304 CAGGAGTTCAAGGCCAGCGTGGG - Intronic
1121133276 14:91469770-91469792 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
1121711854 14:96044386-96044408 CAGGAGCTCTAGACCTGCCTGGG - Intronic
1122604059 14:102936699-102936721 GAGGAGTTCAAGGCCAGCCTGGG - Intronic
1123013009 14:105358234-105358256 CAGGAGCTGGACGCCGGCGTGGG + Intronic
1123044399 14:105504188-105504210 GAGGAGCTCTGGGCTGGTGGGGG + Intergenic
1124486991 15:30126549-30126571 CAGGAGCTCAAGGCCAGCCTGGG + Intergenic
1124542074 15:30595524-30595546 CAGGAGCTCAAGGCCAGCCTGGG + Intergenic
1124574630 15:30896681-30896703 TAGGAGCTCCAGACCGGCCTGGG - Intergenic
1124756534 15:32411773-32411795 CAGGAGCTCAAGGCCAGCCTGGG - Intergenic
1127906818 15:63382060-63382082 GAGGAGCTGCTGGCAGGCGTGGG + Exonic
1128045732 15:64616200-64616222 GAGGAGTTCTAGACCAGCCTGGG - Intronic
1129053149 15:72798958-72798980 CAGGAGTTCTAGGCCAGCCTAGG - Intergenic
1129348101 15:74937553-74937575 GAGGCGCTGCAGGCCGGCGGCGG + Intronic
1129637698 15:77339310-77339332 CAGGAGCTCTAGACCAGCCTGGG - Intronic
1130523742 15:84685480-84685502 CAGGAGCTCTAGACCAGCCTGGG - Intronic
1131234379 15:90683328-90683350 CAGGAGTTCTAGACCGGCCTGGG + Intergenic
1131513762 15:93064196-93064218 GAGGAGCCCTAGGCTGGCAAGGG + Intronic
1132568436 16:633746-633768 GAGGAGCCCGAGGCCGCCGGCGG + Exonic
1133134979 16:3704642-3704664 CAGGAGCTCGAGGCCAGCCTAGG + Intronic
1133346562 16:5075110-5075132 CAGGAGTTCAAGGCCGGCCTAGG - Intronic
1133374153 16:5269944-5269966 CAGGAGTTCCAGGCCAGCGTTGG + Intergenic
1133556705 16:6912908-6912930 AAGGAGCTCTAGGCTGGGCTTGG - Intronic
1133814559 16:9186727-9186749 CAGGAGTTCAAGGCCGGCCTGGG - Intergenic
1134099005 16:11438560-11438582 CAGGAGCTCAAGGCCAGCCTGGG + Intronic
1135605151 16:23817720-23817742 TAGGAGCTCGAGGCCAGCCTGGG + Intergenic
1136539068 16:30918490-30918512 CAGGAGCCCAAGGCCAGCGTGGG - Intergenic
1137350322 16:47708062-47708084 GAGGAGTTCAAGGCCAGCCTGGG + Intergenic
1138112119 16:54332047-54332069 CAGGAGCTCAAGGCCAGCCTGGG - Intergenic
1138381255 16:56604275-56604297 CAGGAGCTCGAGGCCAGCCTGGG + Intergenic
1139973327 16:70790066-70790088 AAGGAGCTCTCTGCCAGCGTGGG + Intronic
1140408243 16:74725142-74725164 GAGGAGCTCTGGGCTGGATTTGG + Intronic
1140975481 16:80056127-80056149 CAGGAGTTCTAGACCAGCGTGGG - Intergenic
1141065315 16:80909207-80909229 GAGGAGCTCAAGACCAGCCTGGG - Intergenic
1141093406 16:81146127-81146149 CAGGAGTTCGAGACCGGCGTTGG - Intergenic
1141828659 16:86497667-86497689 GAGGAGCTCGACGCCGGCGGCGG + Intergenic
1141957958 16:87384689-87384711 CAGGAGCTCGAGACCGGCCTGGG + Intronic
1142278648 16:89136630-89136652 GGGGAGCTGCAGGCCGGCCTCGG - Intronic
1142353638 16:89591060-89591082 TAGGAGCTCGAGGCAGGCCTGGG + Intronic
1142685430 17:1574787-1574809 GTGGAGGTCCAGGCCGGGGTGGG - Exonic
1144039736 17:11399628-11399650 GAGGAGCTCGAGACCAGCATGGG - Intronic
1144803814 17:17950500-17950522 CAGGAGCTTGAGGCCGGCCTTGG - Intronic
1145325259 17:21817276-21817298 GAGGAGTTCTAGACCAGCCTGGG - Intergenic
1146053596 17:29570113-29570135 CAGGAGCTCAAGACCAGCGTGGG - Intronic
1146274264 17:31505918-31505940 CAGGAGCTCCAGGCCAGCCTGGG - Intronic
1148214940 17:45829393-45829415 GAGCAGCTCTAGGTTGGGGTGGG + Intronic
1148463235 17:47850069-47850091 AAGGAGCCCCAGGCCGGGGTGGG + Intronic
1149611472 17:57960503-57960525 CAGGAGCTCGAGACCGGCCTGGG - Intergenic
1149621047 17:58045312-58045334 GAGGAGTTCGAGGCCAGCCTGGG + Intergenic
1149864067 17:60140602-60140624 GAGGAGCTCGAGACCAGCCTGGG + Intergenic
1150725399 17:67647524-67647546 GAGGAGCTCGAGACCAGCCTGGG - Intronic
1151384572 17:73747303-73747325 GAGCAGCTCTGGGCAGGCGGAGG + Intergenic
1151825154 17:76519851-76519873 CAGGAGTTCCAGGCCGGCTTGGG + Intergenic
1152114624 17:78378091-78378113 CAGGAGCTCGAGACCGGCCTGGG + Intergenic
1153545041 18:6196445-6196467 GAGGAACTCTAGGCCGGGCACGG - Intronic
1153778746 18:8476391-8476413 GAGGAGCTGCAGGCAGGAGTGGG + Intergenic
1154984629 18:21537327-21537349 GAGGAGTTCAAGGCCAGCCTGGG + Intronic
1155215106 18:23636346-23636368 CAGGAGTTCTAGACCGGCTTGGG - Intronic
1155594354 18:27467647-27467669 CAGGAGTTCTAGGCCAGCCTGGG - Intergenic
1157544330 18:48537482-48537504 GAGGAGCTCAAGACCAGCCTGGG - Intergenic
1157548317 18:48563406-48563428 GAGGAGCTGCAGGCCAGAGTGGG - Intronic
1158592628 18:58790404-58790426 GAGGAGCTCTTGGCTGGTCTGGG - Intergenic
1158988884 18:62848670-62848692 CAGGAGCTCAAGGCCAGCCTCGG - Intronic
1161179433 19:2869655-2869677 GAGGAGATCTAGGCCGGGCGCGG - Intronic
1161969617 19:7570119-7570141 CAGGAGTTCGAGGCCGGCCTGGG - Intergenic
1162115249 19:8425452-8425474 GAGGAGTTCAAGGCCAGTGTGGG - Intronic
1162200910 19:9019257-9019279 GAGGAGTTCAAGACCAGCGTGGG + Intergenic
1162206053 19:9056949-9056971 CAGGAGCTCGAGGCCAGCCTGGG - Intergenic
1162597920 19:11643426-11643448 CAGGAGCTCGAGGCCAGCCTGGG - Intergenic
1162612225 19:11765735-11765757 CAGGAGCTCAAGACCGGCCTGGG - Intergenic
1162667260 19:12224429-12224451 CAGGAGATCGAGGCCGGCCTGGG + Intergenic
1163539416 19:17898454-17898476 TAGGAGTTCGAGGCCGGCCTGGG + Intergenic
1163545342 19:17938129-17938151 CAGGAGCTCCAGGCCAGCCTGGG + Intronic
1163635837 19:18436946-18436968 GCGGAGCCCTGGGCCGGGGTGGG - Intronic
1163737593 19:18990763-18990785 GAGGAGCACCACGCCGGCGGAGG + Intergenic
1164707754 19:30332870-30332892 CAGGAGCTCTAGACCAGCTTGGG + Intronic
1164973402 19:32551515-32551537 TAGGAGCTCAAGGCCAGCCTGGG + Intergenic
1165486555 19:36100046-36100068 GAGGAGTTCAAGGCCAGCCTAGG + Intronic
1165695735 19:37899654-37899676 CAGGAGCTCAAGGCCAGCCTGGG - Intronic
1165987124 19:39779158-39779180 TAGGAGCTCGAGGCCAGCCTGGG - Intronic
1166354032 19:42216801-42216823 CAGGAGCTCTAGGCCGCTGCGGG + Exonic
1166701884 19:44886830-44886852 TAGGAGCTCGAGACCAGCGTGGG + Intronic
1166878963 19:45915185-45915207 CAGGACCTCTAGGCCAGCGTGGG + Intergenic
1167037948 19:47005320-47005342 CAGGAGCTGCAGGCAGGCGTGGG + Intergenic
1168405532 19:56108384-56108406 GGGGAGCTCTGGGCAGGGGTTGG - Intronic
1168557350 19:57354212-57354234 CAGGAGCTCTAGACCAGCCTGGG - Intronic
1168665385 19:58201218-58201240 CAGGAGTTCTAGACCGGCCTGGG - Intronic
925034834 2:677108-677130 GAGTGGCTCGGGGCCGGCGTCGG - Intronic
925616332 2:5747663-5747685 GAGGAGCTTCAGGCAGTCGTAGG - Intergenic
926257914 2:11225546-11225568 CAGGAGCTCAAGGCCAGCCTGGG - Intronic
926909383 2:17836446-17836468 TAGGAGCTCAAGGCCTGCCTGGG - Intergenic
927024911 2:19057267-19057289 CAGGAGCTCTAGACCAGCCTGGG + Intergenic
927136260 2:20098488-20098510 GAGTAGCTGTAGCCCGGCTTGGG - Intergenic
929460013 2:42096635-42096657 TAGGAGTTCAAGGCCGGCCTGGG + Intergenic
929707449 2:44228380-44228402 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
930025146 2:47025143-47025165 GCTGAGCTCCAGGCCGGCGGAGG + Intronic
930177259 2:48314376-48314398 GAGGCGCTGTAGGCCGGTGCGGG - Intergenic
932224078 2:70025347-70025369 CAGGAGCTCAAGGCCAGCCTGGG + Intergenic
933896407 2:86814625-86814647 CAGGAGCTCAAGGCCAGCCTGGG + Intergenic
934026732 2:88007157-88007179 TAGGAGCTCTAGCACGGCGCGGG + Intergenic
934908464 2:98228078-98228100 CAGGAGCTCAAGACCAGCGTGGG + Intronic
936714315 2:115167347-115167369 TAGGAGTTCTAGACCAGCGTGGG + Intronic
938237298 2:129716828-129716850 GTGGAGCTTTAGGCCATCGTGGG - Intergenic
940938086 2:159523192-159523214 CAGGAGTTCTAGGCCAGCCTGGG + Intronic
941708653 2:168687910-168687932 CAGGAGCTCAAGACCGGCCTGGG - Intronic
945287233 2:208094775-208094797 CAGGAGCTCAAGGCCAGCCTGGG - Intergenic
945364035 2:208928945-208928967 TAGGAGTTCAAGGCCAGCGTGGG + Intergenic
945765431 2:213970508-213970530 CAGGAGCTCGAGGCCAGCCTGGG - Intronic
946367463 2:219257884-219257906 TAGGAGCTCTAGACCAGCTTGGG - Intronic
947728675 2:232416446-232416468 AAGGAGCACTAGGCCAGCCTAGG + Intergenic
948421383 2:237862706-237862728 GAGGGGTTCTAGGCCTGAGTTGG - Intronic
948693583 2:239721671-239721693 GGGCAGCTCTTGGCCGGCGATGG + Intergenic
949051121 2:241897941-241897963 CAGGAGCTCAAGACCGGCCTGGG - Intronic
1169444322 20:5658764-5658786 GAGGAGTTTTGGGCCGGCCTGGG + Intergenic
1170825425 20:19790584-19790606 GAGGAGTTCAAGGCCAGCCTGGG + Intergenic
1171469279 20:25356924-25356946 CAGGAGCTCAAGGCCAGCCTGGG + Intronic
1171776419 20:29372491-29372513 GAGGAGCACTAGGCTGAAGTTGG + Intergenic
1171817689 20:29802979-29803001 GAGGAGCACTAGGCTGAAGTTGG + Intergenic
1171900549 20:30852292-30852314 GAGGAGCACTAGGCTGAAGTTGG - Intergenic
1172250910 20:33478466-33478488 CAGGAGCTCTAGACCAGCCTGGG + Intergenic
1172854630 20:37992483-37992505 CAGGAGCTCCAGGCCAGCCTGGG - Intronic
1175475155 20:59267634-59267656 GAGGAGCTCGAGACCAGCCTGGG - Intergenic
1176313408 21:5218123-5218145 GAGGAGCTCCAGACCAGCCTGGG + Intergenic
1176407475 21:6429116-6429138 GAGGAGCTCAAGAGCGGCCTGGG + Intergenic
1176732734 21:10517155-10517177 CAGGAGTTCTAGGCCAGCCTGGG - Intergenic
1179216899 21:39375148-39375170 CAGGAGCTCTAGACCAGCCTGGG - Intergenic
1179634959 21:42703027-42703049 GCGGAGGCCTAGGCCGGGGTGGG + Intronic
1179682979 21:43037519-43037541 GAGGAGCTCAAGAGCGGCCTGGG + Intergenic
1180321135 22:11322469-11322491 GAGGAGCACTAGGCTGAAGTTGG + Intergenic
1180333908 22:11558276-11558298 GAGGAGCACTAGGCTGAAGTTGG - Intergenic
1180697246 22:17759647-17759669 CAGGAGCTCAAGGCCAGCCTGGG + Intronic
1181008991 22:20029234-20029256 GAGGAGCCCTAGGCTGGAGAGGG + Intronic
1181036577 22:20172540-20172562 CAGGAGCTCTGGGAAGGCGTGGG + Intergenic
1181600737 22:23950359-23950381 CAGGAGTTCTAGGCCAGCCTCGG - Intergenic
1181607776 22:23990960-23990982 CAGGAGTTCTAGGCCAGCCTCGG + Intergenic
1181904071 22:26179178-26179200 CAGGAGCTCTAGACCAGCCTGGG + Intronic
1182364898 22:29771952-29771974 GAGGAGCTGTAGGCCGGGCGTGG + Intergenic
949467927 3:4362711-4362733 CAGGAGCTCGAGGCCAGCCTGGG + Intronic
950428712 3:12938722-12938744 GGGGAGCTCTAGGCCTGAGCTGG - Intronic
950652704 3:14417122-14417144 CAGGAGCTCGAGACCAGCGTGGG + Intronic
952490796 3:33870735-33870757 GAGGAGTTCAAGGCCAGCCTGGG - Intergenic
953150623 3:40320934-40320956 CAGGAGTTCTAGGCCAGCCTGGG + Intergenic
953683286 3:45056448-45056470 CAGGAGCTCCAGGCCAGCCTGGG - Intergenic
955256417 3:57337297-57337319 CAGGAGCTCCAGACCGGCCTGGG + Intronic
956530571 3:70213179-70213201 CAGGAGCTCTAGTCCAGCCTGGG - Intergenic
957088668 3:75707172-75707194 GAGGAGCACTAGGCTGAAGTTGG - Intergenic
963192409 3:142487343-142487365 GAGGAGTTCAAGGCCAGCCTAGG - Intronic
964199243 3:154099505-154099527 CAGGAGTTCTAGGCCAGCTTGGG + Intergenic
966764208 3:183445629-183445651 CAGGAGCTCTAGGCCAGCCTGGG - Intergenic
967511905 3:190322351-190322373 GAGAAGCTCTGGGTCGGGGTTGG + Exonic
967911902 3:194549411-194549433 CAGGAGTTCTAGGCCAGCCTGGG + Intergenic
968815932 4:2821751-2821773 CAGGAGCTCCAGGCCAGCCTGGG - Intronic
970575892 4:17427346-17427368 GAGGAGTTCTAGACCAGCCTGGG - Intergenic
970588859 4:17541212-17541234 CAGGAGCTCGAGGCCAGCCTGGG + Intergenic
972423015 4:38907155-38907177 GAGGACCTCTAGACTGGGGTGGG + Intronic
972689209 4:41380353-41380375 GAGGAGATCAAGGCCAGCCTAGG - Intronic
972975515 4:44630174-44630196 CAGGAGCTCTAGACCAGCCTGGG - Intronic
977234944 4:94496696-94496718 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
978856826 4:113403136-113403158 GAGGAGCTCTTGGCATGGGTGGG - Intergenic
982040111 4:151389123-151389145 CAGGAGCTCGAGGCCAGCCTGGG + Intergenic
982557431 4:156885680-156885702 CAGGAGCTCAAGGCCAGCCTGGG + Intronic
982694124 4:158580257-158580279 GAGGAGCTCTAGGTCTGGATTGG + Intronic
985023595 4:185717118-185717140 GAAGAGCTCGTGGCTGGCGTGGG + Intronic
985441974 4:189988542-189988564 GAGGAGCACTAGGCTGAAGTTGG + Intergenic
985520279 5:370886-370908 GTGGAGCTCTCGGCCGACCTCGG + Intronic
987054205 5:14176096-14176118 GAGGAGTTCAAGGCCAGCCTGGG + Intronic
989075233 5:37558532-37558554 GAGGAGTTCAAGACCAGCGTGGG - Intronic
991773823 5:70064783-70064805 CAGGAGTTCCAGGCCAGCGTGGG - Intronic
991853117 5:70940207-70940229 CAGGAGTTCCAGGCCAGCGTGGG - Intronic
992349003 5:75910352-75910374 GAGGAGCTGAAGGCCATCGTAGG - Intergenic
992440870 5:76796659-76796681 GAGGAGCTCAAGACCAGCCTGGG - Intergenic
994587693 5:101730811-101730833 CAGGAGCTCGAGGCCAGCCTAGG + Intergenic
995341234 5:111062936-111062958 CAGGAGCTCTAGACCAGCCTGGG + Intergenic
995650052 5:114360970-114360992 GAGCAGCTGGAGGCCGGCGGTGG + Exonic
997613541 5:135231374-135231396 GTGGAGCTAGAGGCCAGCGTAGG + Intronic
1001061676 5:168495938-168495960 CAGGAGTTCTAGGCCAGCTTGGG + Intronic
1002606748 5:180387912-180387934 CAGGAGTTCAAGGCCGGCCTGGG + Intergenic
1002720922 5:181261179-181261201 GAGACGCTCTAGGCCGGCGGAGG + Intergenic
1006929906 6:37681291-37681313 CAGGAGCTCCAGGCCAGCCTCGG + Intronic
1007774917 6:44219576-44219598 GCGGAGCTCTGGGCGGGCGCTGG + Intronic
1009818181 6:68763862-68763884 CAGGAGCTCAAGGCCAGCCTGGG + Intronic
1010361526 6:75000693-75000715 GAGGAGATCAAGGCCAGCCTGGG + Intergenic
1013114742 6:107094161-107094183 GAGGAGCTCGAGACCAGCCTGGG + Intronic
1013468617 6:110440365-110440387 GAGGAGCTCTGGGCTGGGGATGG + Intronic
1015789333 6:136950790-136950812 GAGGAGCTCAGGGCAGGCGCAGG + Intergenic
1016478877 6:144459796-144459818 CAGGAGTTCTAGACCAGCGTGGG - Intronic
1016993771 6:149947017-149947039 GAGGATCTCTGGGCTGGCGTTGG - Intronic
1017140253 6:151183678-151183700 TAGGAGCTCGAGGCCAGCCTGGG - Intergenic
1017834097 6:158161165-158161187 CAGGAGCTCTAGGCCAGCCCAGG + Intronic
1017914874 6:158823825-158823847 GAGGAGTTCAAGACCGGCCTGGG - Intergenic
1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG + Exonic
1020136124 7:5588982-5589004 CAGGAGCTCAAGGCCAGCCTGGG + Intergenic
1020231851 7:6325183-6325205 CAGGAGTTCTAGGCCAGCCTGGG - Intergenic
1022384094 7:29885600-29885622 CAGGAGTTCTAGGCCAGCCTGGG + Intronic
1029442613 7:100595409-100595431 CAGGAGCTCTAGACCAGCCTGGG + Intronic
1030683701 7:112460449-112460471 CAGGAGCTCAAGGCCAGCCTGGG - Intronic
1032712532 7:134473290-134473312 CAGGAGTTCTAGGCCAGCCTGGG - Intergenic
1034340179 7:150347733-150347755 GAGGAGTTCAAGGCCAGCCTGGG + Intergenic
1034441275 7:151087118-151087140 GTGGAGCCCTCGGCCGGCGCCGG - Intronic
1036476198 8:9095727-9095749 CAGGAGTTCAAGGCCAGCGTGGG - Intronic
1036974691 8:13397618-13397640 CAGGAGCTCTAGACCAGCCTGGG + Intronic
1038151198 8:24943198-24943220 GAGGAGCTCTGGGCTGGGGAGGG - Intergenic
1038783141 8:30585874-30585896 CAGGAGCTCAAGGCCAGCCTGGG + Intronic
1039515690 8:38131433-38131455 CAGGAGCTCGAGGCCAGCCTGGG + Intronic
1039806636 8:41005503-41005525 CAGGAGCTCTAGACCAGCCTGGG + Intergenic
1039990850 8:42486403-42486425 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
1041720508 8:60971285-60971307 CAGGAGCTCCAGGCCAGCCTGGG - Intergenic
1041791189 8:61698005-61698027 GAGGAGTTCAAGACCAGCGTGGG - Intronic
1042696952 8:71564828-71564850 GAGGAGTTCAAGGCCAGCCTGGG + Intronic
1042869069 8:73380917-73380939 CAGGAGCTCAAGGCCAGCCTGGG + Intergenic
1043987619 8:86712797-86712819 GAGGAGTTCAAGGCCCGCCTAGG - Intronic
1045284221 8:100776001-100776023 GAGGAGCTCCAGACCAGCCTGGG + Intergenic
1046872866 8:119222617-119222639 CAGGAGCTCAAGGCCAGCCTGGG + Intronic
1047267647 8:123322458-123322480 CAGGAGCTCAAGATCGGCGTGGG + Intronic
1047764630 8:127980449-127980471 GATGGGCTCTGGGCCAGCGTTGG + Intergenic
1049739788 8:144233036-144233058 CAGGAGCTCTAGACTGGCCTGGG - Intronic
1051079668 9:13279595-13279617 GCGGAGCGCTAGGCTGGCGTCGG - Intergenic
1051613810 9:18987688-18987710 CAGGAGCTCAAGGCCAGCCTGGG + Intronic
1052819337 9:33126486-33126508 CAGGAGCTCAAGGCCAGCCTGGG - Intronic
1052963254 9:34318716-34318738 GAGGAGGTGCACGCCGGCGTGGG + Intronic
1053345863 9:37377854-37377876 CAGGAGCTCAAGGCCAGCCTGGG - Intergenic
1054715889 9:68557442-68557464 CAGGAGCTCAAGGCCAGCCTGGG + Intergenic
1056371980 9:85965417-85965439 GAGGAGTTCGAGGCCAGCCTAGG + Intronic
1056386250 9:86099483-86099505 CCGGAGCTCGAGGCCGGCGGCGG - Exonic
1057612876 9:96561930-96561952 GAGGAGCTCTAAGCTGGCTCTGG + Intronic
1057693175 9:97305123-97305145 TAGGAGTTCGAGGCCAGCGTGGG + Intergenic
1058636142 9:107040501-107040523 CAGGAGCTCGAGGCCAGCCTGGG + Intergenic
1058936010 9:109770123-109770145 GAGGAGCTCTTGGGCTGGGTCGG + Intronic
1059093395 9:111386170-111386192 GAGGAGTTCAAGACCAGCGTGGG - Intronic
1059420384 9:114186893-114186915 GAGGAGCTCTAGGGCAGAGGTGG + Intronic
1060745558 9:126128629-126128651 CAGGTGCTCCAGGCCGGAGTGGG + Intergenic
1061415769 9:130446058-130446080 CAGGAGCTCGAGGCCAGCCTGGG - Intronic
1061979411 9:134092343-134092365 CAGGAGCTCAAGACCAGCGTGGG + Intergenic
1062497969 9:136840511-136840533 GAGGAGCTCTAGGCCGGCGTGGG + Exonic
1203460401 Un_GL000220v1:31106-31128 CAGGAGCCCTTGGCCGGAGTGGG + Intergenic
1203369349 Un_KI270442v1:288241-288263 GAGGAGCACTAGGCTGAAGTTGG + Intergenic
1185781980 X:2855677-2855699 GAGGAGTTCAAGACCGGGGTGGG + Intronic
1186651661 X:11567884-11567906 CAGGAGCTCGAGACCAGCGTGGG - Intronic
1186766099 X:12772012-12772034 GAGGAGCTCGAGACCAGCCTGGG - Intergenic
1187141258 X:16596080-16596102 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
1189307430 X:39997438-39997460 GAGGAGCTGGAGGCTGGCATTGG - Intergenic
1190003206 X:46709193-46709215 CAGGAGTTCGAGACCGGCGTGGG + Intronic
1190022416 X:46891206-46891228 GAGGAGTTCAAGGCCAGCCTGGG + Intronic
1190340362 X:49291193-49291215 GAGGAGCTCGAGACCAGCCTGGG - Intronic
1193149623 X:78111294-78111316 CAGGAGCTCAAGGCCAGCTTGGG - Intronic
1196396251 X:115264516-115264538 CAGGAGCTCTAGACCAGCCTGGG + Intergenic
1197949862 X:131882738-131882760 CAGGAGCTCAAGGCCAGCCTGGG - Intergenic
1201068936 Y:10126720-10126742 GAGGAGCACTAGGCTGAAGTTGG - Intergenic
1201414648 Y:13736042-13736064 GAGGAGCTCTGGCCAGGTGTGGG - Intergenic
1201759619 Y:17522712-17522734 GAGGAGCACTAGGCTGAAGTTGG + Intergenic
1201841935 Y:18383278-18383300 GAGGAGCACTAGGCTGAAGTTGG - Intergenic
1202202449 Y:22367471-22367493 CAGGAGTTCTGGGTCGGCGTGGG - Intronic