ID: 1062498427

View in Genome Browser
Species Human (GRCh38)
Location 9:136842389-136842411
Sequence GGTGCAGCCCCCACTGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062498419_1062498427 6 Left 1062498419 9:136842360-136842382 CCAGTGCAGCTCATGATCCCCAG 0: 1
1: 1
2: 1
3: 17
4: 156
Right 1062498427 9:136842389-136842411 GGTGCAGCCCCCACTGGGTGCGG No data
1062498416_1062498427 19 Left 1062498416 9:136842347-136842369 CCCCAAATTGGAGCCAGTGCAGC 0: 1
1: 2
2: 0
3: 9
4: 128
Right 1062498427 9:136842389-136842411 GGTGCAGCCCCCACTGGGTGCGG No data
1062498417_1062498427 18 Left 1062498417 9:136842348-136842370 CCCAAATTGGAGCCAGTGCAGCT 0: 1
1: 2
2: 1
3: 13
4: 127
Right 1062498427 9:136842389-136842411 GGTGCAGCCCCCACTGGGTGCGG No data
1062498418_1062498427 17 Left 1062498418 9:136842349-136842371 CCAAATTGGAGCCAGTGCAGCTC 0: 1
1: 2
2: 0
3: 13
4: 106
Right 1062498427 9:136842389-136842411 GGTGCAGCCCCCACTGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062498427 Original CRISPR GGTGCAGCCCCCACTGGGTG CGG Intronic
No off target data available for this crispr