ID: 1062499531

View in Genome Browser
Species Human (GRCh38)
Location 9:136846309-136846331
Sequence GGCGCTGCCGGCCGAGGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 1, 2: 6, 3: 46, 4: 622}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062499531_1062499539 -4 Left 1062499531 9:136846309-136846331 CCCCCGCCTCGGCCGGCAGCGCC 0: 1
1: 1
2: 6
3: 46
4: 622
Right 1062499539 9:136846328-136846350 CGCCGAGGAGCCCGCGGCCCCGG 0: 1
1: 0
2: 5
3: 41
4: 312
1062499531_1062499542 2 Left 1062499531 9:136846309-136846331 CCCCCGCCTCGGCCGGCAGCGCC 0: 1
1: 1
2: 6
3: 46
4: 622
Right 1062499542 9:136846334-136846356 GGAGCCCGCGGCCCCGGGAGAGG 0: 3
1: 0
2: 3
3: 45
4: 445
1062499531_1062499538 -10 Left 1062499531 9:136846309-136846331 CCCCCGCCTCGGCCGGCAGCGCC 0: 1
1: 1
2: 6
3: 46
4: 622
Right 1062499538 9:136846322-136846344 CGGCAGCGCCGAGGAGCCCGCGG 0: 1
1: 1
2: 4
3: 24
4: 198
1062499531_1062499543 5 Left 1062499531 9:136846309-136846331 CCCCCGCCTCGGCCGGCAGCGCC 0: 1
1: 1
2: 6
3: 46
4: 622
Right 1062499543 9:136846337-136846359 GCCCGCGGCCCCGGGAGAGGCGG 0: 3
1: 0
2: 4
3: 43
4: 376
1062499531_1062499540 -3 Left 1062499531 9:136846309-136846331 CCCCCGCCTCGGCCGGCAGCGCC 0: 1
1: 1
2: 6
3: 46
4: 622
Right 1062499540 9:136846329-136846351 GCCGAGGAGCCCGCGGCCCCGGG 0: 1
1: 0
2: 5
3: 40
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062499531 Original CRISPR GGCGCTGCCGGCCGAGGCGG GGG (reversed) Exonic
900091837 1:924114-924136 GGCGCTGGTGGCCGGGGCGCGGG + Intergenic
900126834 1:1072465-1072487 GGGGCTGCCGGCCGAGCTGGGGG + Exonic
901057624 1:6456015-6456037 GGCGCGGCGGGCGGGGGCGGCGG - Intronic
901109574 1:6784750-6784772 GTCGCTGCCGGCCGTGGGGGAGG - Intergenic
901514325 1:9734899-9734921 GGGGTTTCCGGCCGAGGCGAGGG + Intronic
901836347 1:11926294-11926316 GGCGCGGGCGGCCGGGCCGGTGG - Exonic
902920546 1:19664271-19664293 GTCGCTGCAGGCAGAGGCGTGGG - Intergenic
903115632 1:21176585-21176607 GGCGGCGGCGGCGGAGGCGGCGG - Intronic
903115637 1:21176597-21176619 GCTGCTGCCGGCGGCGGCGGCGG - Intronic
903205997 1:21783000-21783022 GGCGGTGCAGACCGCGGCGGCGG - Exonic
903907292 1:26696171-26696193 GGCGGCGGCGGCCGAGGCGCCGG - Exonic
903907455 1:26696659-26696681 GGCGGAGCCGGCAGCGGCGGCGG + Exonic
903936718 1:26900418-26900440 GGCGGTGCCCGGCGAGGCGGAGG - Exonic
904587213 1:31587056-31587078 GGCTCTGTCGGGCGAGGCTGGGG - Exonic
904696938 1:32336124-32336146 GGGGCTGGCGCCCGAGGGGGAGG + Exonic
904724876 1:32539651-32539673 GGCTCTGACGGCCCGGGCGGCGG + Intronic
904756169 1:32770007-32770029 GGCGCTGGAGGCGGAGGCGGAGG + Exonic
904822730 1:33256167-33256189 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
905107550 1:35573498-35573520 AGCGCTGCGGGCAGAGGCGCCGG - Exonic
905212704 1:36385643-36385665 GGCCCCGGCGGCCGCGGCGGTGG - Intronic
905379862 1:37554145-37554167 GGTGCTGCCGGCGGGGGTGGTGG - Exonic
905449002 1:38045431-38045453 AGCGCCGCCGGCGGGGGCGGTGG + Exonic
905692703 1:39955012-39955034 AGAGCCGCCGGGCGAGGCGGGGG + Intergenic
905847104 1:41242205-41242227 GGCGGTGGCGGCTGAGGCGGGGG + Intergenic
906027027 1:42682609-42682631 GGCGCTGAGGGCGGGGGCGGCGG - Exonic
906365391 1:45205895-45205917 GGCGGAGCCGGCCGGAGCGGCGG + Exonic
907010645 1:50959919-50959941 GGGGCTGGCGGGCGAGCCGGCGG + Exonic
908240086 1:62181704-62181726 AGCACTGCCTGCTGAGGCGGGGG + Intergenic
908355617 1:63323106-63323128 GGTGCTGACGGCCGAGGACGTGG + Exonic
908534648 1:65066748-65066770 GGCGGTGCCGGAGGAGGAGGAGG - Intergenic
909001428 1:70221706-70221728 GGTGGTGGCGGCGGAGGCGGCGG + Exonic
910788033 1:91021771-91021793 GGCGGCGGCGGCCGAGGAGGCGG - Intronic
913703591 1:121397085-121397107 GGCGCTGCCTGTGGAGGCGGTGG + Intergenic
913979941 1:143498796-143498818 GGCGCTGCCTGTGGAGGCGATGG + Intergenic
914074290 1:144324280-144324302 GGCGCTGCCTGTGGAGGCGATGG + Intergenic
914104886 1:144642166-144642188 GGCGCTGCCTGTGGAGGCGATGG - Intergenic
914214101 1:145608459-145608481 GGCGCCGCCAGCTAAGGCGGCGG + Intronic
914466046 1:147928862-147928884 GGCGCCGCCAGCTAAGGCGGCGG + Intronic
914908096 1:151763199-151763221 GGGGCTGGCGGCCGTGGTGGAGG - Intronic
915200114 1:154220995-154221017 GGCGTTGGCGGCGGCGGCGGCGG + Intronic
915247641 1:154567905-154567927 GGTGGTGCCGGCCGCCGCGGTGG - Exonic
915356078 1:155255722-155255744 GGCGTTCCCGGCAGAGGCGGTGG + Intergenic
915393269 1:155562868-155562890 GGCGGCGGCGGCCGTGGCGGCGG - Intergenic
915393272 1:155562880-155562902 GGGGCTGGCGGCGGCGGCGGCGG - Intergenic
915463189 1:156081736-156081758 GGCGCCGCGGGCGGCGGCGGCGG + Exonic
917345199 1:174022226-174022248 GGCGGTGCTGGCGGTGGCGGCGG - Exonic
917755391 1:178093778-178093800 GGCGGTGGCGGCGGCGGCGGCGG - Intergenic
917869598 1:179229638-179229660 GGCGGTGGCGGCGGCGGCGGCGG - Intronic
919724548 1:200873313-200873335 GCCGCTGTGGGCCGCGGCGGCGG + Exonic
919748627 1:201023480-201023502 GGCGCGGCTGGCGGAGGCTGCGG + Exonic
921229204 1:213051378-213051400 GGCGGCGGCGGCAGAGGCGGCGG + Exonic
921472723 1:215567714-215567736 GCCGCTGCCGGCCGCCGCCGCGG - Exonic
922780662 1:228250005-228250027 GAAGGTGCAGGCCGAGGCGGGGG + Exonic
922781538 1:228256691-228256713 GGAGGTGCAGGCCCAGGCGGGGG + Exonic
922783026 1:228268570-228268592 GGAGGTGCAGGCTGAGGCGGGGG + Exonic
922783831 1:228273312-228273334 GGAGGTGCAGGCGGAGGCGGGGG + Exonic
923141481 1:231163786-231163808 GGCGCCCCCAGCGGAGGCGGCGG + Exonic
1064185481 10:13158481-13158503 GGTGCTGGTGGCGGAGGCGGCGG - Intergenic
1064230926 10:13528890-13528912 GGCGGCGGCGGCGGAGGCGGGGG + Intronic
1064354672 10:14605896-14605918 GGCGGTGCCAGCAGAGGGGGAGG - Intronic
1064384511 10:14878715-14878737 CGCGCTGGCCGCCGCGGCGGGGG + Intergenic
1065099759 10:22321378-22321400 GGCGGCGGCGGCCGAGGAGGAGG + Exonic
1065099775 10:22321423-22321445 GGCGTTGGAGGTCGAGGCGGAGG + Exonic
1065342700 10:24722772-24722794 GGGGACGCCGGCCGGGGCGGAGG - Intronic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1069504909 10:68989054-68989076 GGGGCTGCCGGCTGAGGTGGTGG + Exonic
1069818396 10:71212864-71212886 GGCGCTGCCGGGCGCCGGGGAGG + Exonic
1069984449 10:72273921-72273943 GGCGCAGCAGGCCAAGGGGGAGG + Exonic
1070328205 10:75401346-75401368 GGCGGCGGCGGCGGAGGCGGAGG - Exonic
1071086526 10:81874119-81874141 GACGCTGCTGGGCGAGGGGGCGG - Intergenic
1072713952 10:97737146-97737168 GGCGGTGGCGGCCGCGGCGTAGG + Exonic
1073110917 10:101062599-101062621 GCAGCTGCGGGCCGCGGCGGCGG - Exonic
1074503357 10:114045007-114045029 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
1075430302 10:122374785-122374807 GGTGCTCCGGGCCGAGGCCGCGG + Exonic
1075519285 10:123134586-123134608 GCCGCTGCTTGCCGCGGCGGAGG + Intergenic
1075629318 10:123991687-123991709 GGCGGTGGCGGCGGCGGCGGAGG + Intergenic
1076373889 10:129971312-129971334 GGCGCCGGCAGCCGTGGCGGCGG + Intergenic
1076554241 10:131311646-131311668 CGCGCTGACGGCGGCGGCGGGGG + Exonic
1077026315 11:441569-441591 GGGCCTGCCCACCGAGGCGGGGG - Intronic
1077136546 11:1002301-1002323 GGAGGAGCCGGCCGAGGCGGAGG - Intronic
1077297451 11:1832708-1832730 GGCGCTGGCTGCCGATGCTGGGG - Intronic
1077309700 11:1882899-1882921 GGGGCTGCCGGCTGCGGGGGAGG - Intronic
1077495442 11:2884713-2884735 GGCGCTGGCGGCCGCGGTGCCGG + Exonic
1077524737 11:3057314-3057336 GGCGCGGCCGGGCCAGGCTGAGG - Intronic
1078390208 11:10930858-10930880 GCTGCGGCCGGGCGAGGCGGCGG - Intergenic
1079128535 11:17734956-17734978 GGCGCTGCCGGCCGAGACGGGGG - Exonic
1079163138 11:18012875-18012897 GGAGCTGCTGGCCGCGGCGTGGG - Intronic
1079180417 11:18188919-18188941 GGCGCTGACGGCGGTGGCGGGGG + Exonic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1080529529 11:33161492-33161514 GCCCCTGCCGGCCGAGGAGGAGG + Intronic
1081831600 11:46120384-46120406 GGGGCTGCGGGCGGGGGCGGGGG - Intronic
1081831981 11:46121714-46121736 GGAGCCGCGGGCCGAGGCGCGGG - Intergenic
1083672132 11:64305625-64305647 GGCGCGGCCCGAGGAGGCGGCGG + Intronic
1083896433 11:65622174-65622196 GGGGCTGACGGCCGCGGCTGTGG + Intronic
1083945042 11:65918998-65919020 GGCGGCGGCGGCCGTGGCGGGGG - Exonic
1084000150 11:66291774-66291796 GGCGCTGCCGGCGGCGCCGCCGG + Intergenic
1084083396 11:66843506-66843528 GGAGCGGCCGCCCGAGTCGGCGG + Exonic
1084295923 11:68213414-68213436 GGCGCAGCGAGCCGAGGCCGGGG - Exonic
1084792655 11:71484451-71484473 GGGGACGCCGGCCCAGGCGGGGG - Intronic
1087634567 11:100687650-100687672 GGCGCTGCCAGCGGCGGCCGCGG - Intronic
1087672758 11:101127556-101127578 GGCGGCGGCGGCAGAGGCGGAGG + Exonic
1089432711 11:118436686-118436708 GGCTGTGGCGGCCGCGGCGGCGG + Exonic
1090399649 11:126440959-126440981 GGTGCCGCTGGCTGAGGCGGGGG - Intronic
1091616079 12:2052549-2052571 GGGGCTGCAGGCCGGCGCGGGGG + Intronic
1092206965 12:6620654-6620676 CGTGCTGCTGGCCGAGGCGCTGG - Exonic
1092383592 12:8018716-8018738 GTCACTGCCGGGCGCGGCGGCGG - Intergenic
1092704421 12:11267764-11267786 GGCTTTCCCGGACGAGGCGGGGG + Exonic
1092704442 12:11267827-11267849 GGCTTTCCCGGACGAGGCGGGGG + Exonic
1093462473 12:19419235-19419257 GGCGCTGGGAGCCGAGGAGGAGG - Intronic
1095752802 12:45729686-45729708 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
1096116810 12:49059959-49059981 GGCGCGGGCGGCCGGGGCGCTGG - Intergenic
1096156928 12:49346179-49346201 AGCGCTGCAGGGCGAGGCGGAGG + Intergenic
1096674678 12:53220159-53220181 GGCGCCGCCGGGGGAGGAGGGGG - Intronic
1096783878 12:54006224-54006246 GGCCGGGCCGGCCGAGGCGCGGG - Intronic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1097039446 12:56146398-56146420 GGGGAGGCCGGCCGAGGCAGAGG + Intergenic
1097990094 12:65825015-65825037 GGCGCTGCCGGTGGCGGCGGCGG - Exonic
1098029005 12:66235286-66235308 ATCGCTGCGGGCCGCGGCGGCGG + Intronic
1100565631 12:95790916-95790938 GCCGCTGCCGCCCGGGGGGGGGG + Intronic
1101965576 12:109279806-109279828 GTCGCTGCCACCCGAGGCAGGGG + Exonic
1101970689 12:109309958-109309980 GGCGGTGGCGGCGGCGGCGGAGG + Intergenic
1101970691 12:109309964-109309986 GGCGGCGGCGGCGGAGGCGGAGG + Intergenic
1102053623 12:109880433-109880455 GGCGCTGACGGCGGCGGCCGGGG - Exonic
1102197411 12:111034862-111034884 GGCTCTGGCGGCGGCGGCGGCGG - Intronic
1102310671 12:111842310-111842332 GGTGCAGGCGGCGGAGGCGGAGG + Intronic
1103309092 12:119989940-119989962 GGAGCTGCCCGCCGCGGCCGGGG + Exonic
1103325414 12:120116893-120116915 GGCGCGGCCGGCTCAGGCTGCGG - Intronic
1103595356 12:122021819-122021841 CGCACTGCCGGCGGCGGCGGCGG + Exonic
1103725482 12:122995581-122995603 GGCGGTGGCGGCGGTGGCGGTGG - Exonic
1103954259 12:124567604-124567626 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1104444714 12:128823865-128823887 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1104568299 12:129903956-129903978 GGCCGGGCGGGCCGAGGCGGCGG - Intergenic
1104927636 12:132321937-132321959 GGTGCAGGGGGCCGAGGCGGGGG - Intronic
1105352434 13:19627812-19627834 GGCACTACCGGCTGTGGCGGGGG - Intergenic
1105407329 13:20143162-20143184 GGTGCTGGGGGCCGCGGCGGAGG - Exonic
1106269486 13:28139102-28139124 GGCGGGGCGGGCCGCGGCGGCGG + Intronic
1106956401 13:34942887-34942909 GGGGCCGCTGGCGGAGGCGGCGG + Exonic
1110119741 13:71866468-71866490 GGCGGTGGCGGCGGCGGCGGTGG - Exonic
1110558514 13:76886262-76886284 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
1110558517 13:76886271-76886293 GGCGGTGGCGGCGGTGGCGGCGG - Exonic
1110630151 13:77698100-77698122 GGCGCGGCGGGCGGCGGCGGCGG - Intronic
1110705953 13:78602208-78602230 GGCGGTGGCGGCCCGGGCGGCGG - Exonic
1111203557 13:84972933-84972955 GGCGCTGCCAGCTGAGGAGATGG + Intergenic
1111951314 13:94711543-94711565 GGGGCTGCCCGCGGCGGCGGCGG + Exonic
1112091664 13:96090357-96090379 CCCGCGGCCGGCCGGGGCGGCGG + Intergenic
1112505035 13:99970408-99970430 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1112507708 13:99985135-99985157 GGCGAGGCAGGCCGAGGCGCCGG + Intronic
1113541814 13:111115270-111115292 GGCGACGGCGGCCGAGGCCGGGG + Exonic
1113615537 13:111677912-111677934 GACGCAGCCGGCCCAGGAGGGGG + Intergenic
1113621005 13:111762814-111762836 GACGCAGCCGGCCCAGGAGGGGG + Intergenic
1114194027 14:20461392-20461414 GGCGGTGGCGGCGGTGGCGGTGG - Exonic
1114519003 14:23321466-23321488 GGCGATGGCGGCGGCGGCGGCGG + Exonic
1114519021 14:23321519-23321541 GGGGCTCCGGGCCGGGGCGGCGG + Exonic
1114523309 14:23352283-23352305 GGCGCTGCTCGCCCAGGTGGGGG - Exonic
1115651390 14:35404714-35404736 GGCGCTGGCGGGCGGGACGGCGG + Exonic
1116435151 14:44887769-44887791 GGCGGTGGAGGCTGAGGCGGCGG - Intergenic
1116916717 14:50532474-50532496 GGAGCTGCCGGCCGGCGCGCGGG - Exonic
1116928606 14:50668040-50668062 GGCGGCGCCGGCGGAGGTGGCGG - Exonic
1118463906 14:66013736-66013758 GGCGCTGAGGGCGGGGGCGGCGG + Intergenic
1118971501 14:70641907-70641929 GGGGCCGGCGTCCGAGGCGGCGG + Exonic
1119290398 14:73491052-73491074 GGCGCGGGCGGCCGAAGCGCCGG + Exonic
1121283857 14:92719261-92719283 GGCGGTGGCGGCGGCGGCGGTGG - Intronic
1121283865 14:92719285-92719307 GGCGGTGGCGGCGGCGGCGGCGG - Intronic
1121283868 14:92719294-92719316 GGCGGTGGCGGCGGTGGCGGCGG - Intronic
1121283873 14:92719309-92719331 GGCGGTGGCGGCGGCGGCGGTGG - Intronic
1121417423 14:93788773-93788795 AGGGCTGGCCGCCGAGGCGGAGG + Intergenic
1121417508 14:93789096-93789118 GGCGCTGGCGGCGGCGGCGGGGG - Intergenic
1122108764 14:99480803-99480825 GGCGGTGGCGGCGGTGGCGGCGG + Exonic
1122271154 14:100568947-100568969 CGCGCTCCCGGCGGACGCGGCGG - Intronic
1122558290 14:102592954-102592976 GGCGGCGGCGGCGGAGGCGGAGG - Exonic
1122558300 14:102592981-102593003 GGCGCAGGCGGCCGAGGCGGCGG - Exonic
1122558317 14:102593041-102593063 GGCGGCGGCGGCCGAGGCTGAGG - Exonic
1122558320 14:102593056-102593078 GGCGGCGGCGGCTGAGGCGGCGG - Exonic
1122609750 14:102973812-102973834 AGCTCTGCCAGCCGACGCGGGGG + Intronic
1122635333 14:103127075-103127097 GGAGCTGGCGGCGGCGGCGGCGG + Exonic
1122652944 14:103236037-103236059 GGCACTACCGGCTGTGGCGGGGG - Intergenic
1122707519 14:103629989-103630011 GGCGGTGCCGGGAGAGGCGGGGG - Intronic
1122784553 14:104157763-104157785 AGCGGTGGCGGCCGTGGCGGTGG + Exonic
1122925646 14:104898250-104898272 GGGGCTGCGGGAGGAGGCGGTGG + Intergenic
1123077146 14:105673016-105673038 ACCGCTGCAGGCCGAGGCTGAGG + Intergenic
1202939855 14_KI270725v1_random:136532-136554 GGCGCTGCGCGCAGAGGCGATGG - Intergenic
1123393269 15:19899345-19899367 GGCGCTGCACGCGGAGGCGATGG + Intergenic
1124373292 15:29115496-29115518 GGGGCTGCTGGCCGTGGGGGCGG - Intronic
1124500368 15:30223077-30223099 GGCGTTGCCCCCGGAGGCGGCGG + Intergenic
1124743205 15:32315589-32315611 GGCGTTGCCCCCGGAGGCGGCGG - Intergenic
1124790156 15:32719013-32719035 GGCGCTGCAAGGCGAGGCTGGGG - Intronic
1125677571 15:41511175-41511197 TGCACTGCGGGCGGAGGCGGCGG - Exonic
1125728928 15:41882217-41882239 GGCGGGGCCCGGCGAGGCGGGGG - Intronic
1126097862 15:45101931-45101953 GGCCCAGCTGGCCGAGGTGGTGG - Exonic
1126392892 15:48178251-48178273 AGCTCAGGCGGCCGAGGCGGAGG - Exonic
1126852392 15:52805365-52805387 CGCTTTGCCGGACGAGGCGGCGG + Intergenic
1127103313 15:55588474-55588496 GGCGCCGCGGGACGAGGCAGCGG - Intronic
1128173291 15:65531193-65531215 GGCGCTGCCGGAGGTGGGGGAGG + Intronic
1128280028 15:66387007-66387029 GGCTGTGCCGCCCGAGCCGGAGG + Exonic
1128454838 15:67826729-67826751 GGTGCTGGCGGCGGTGGCGGCGG + Intronic
1129016721 15:72474868-72474890 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1129309466 15:74695997-74696019 GGCGCTTCCGGCAGCGGCGGCGG - Exonic
1129348282 15:74938167-74938189 CGCGCGGCCGGCGGCGGCGGGGG + Exonic
1129612339 15:77070837-77070859 GGCGGGGCCGGGCGAGGCCGCGG - Intronic
1129682349 15:77664844-77664866 GGGGCTGCTGGCCGTGGCAGGGG + Intronic
1130115300 15:81000945-81000967 GGAGGTTACGGCCGAGGCGGCGG + Exonic
1131054559 15:89367852-89367874 GGGGCTGCGGGCCTAGGTGGCGG + Intergenic
1131977523 15:97961079-97961101 CGCGGTGCTGGCCGAGGCGCGGG - Exonic
1132055680 15:98648997-98649019 GGCGCTGAGGGAGGAGGCGGCGG + Exonic
1132426745 15:101724354-101724376 GGCCCTGGCGGCGGAGGCCGTGG - Exonic
1132519802 16:381901-381923 GGCGGAGGCGGCAGAGGCGGAGG - Exonic
1132519807 16:381916-381938 GGCGCCGGGGGCAGAGGCGGAGG - Exonic
1132656218 16:1043041-1043063 GGCTCTGCTGGCCGAGGGGCGGG - Intergenic
1132683574 16:1153336-1153358 GGCGCTGGGGGCCGGGGCCGGGG + Exonic
1132683593 16:1153370-1153392 GGCGCTGGGGGCCGGGGCCGGGG + Exonic
1132747670 16:1443723-1443745 GGCGGTGCCCGCCGTGGAGGCGG + Intronic
1132885170 16:2179259-2179281 GGCGCTGTGGGCGGCGGCGGCGG + Exonic
1132942246 16:2514059-2514081 AGCTCTGCGGGCCGAGGCGGTGG - Exonic
1133044539 16:3080236-3080258 GGCACTACCGGCTGCGGCGGGGG + Intronic
1133156456 16:3880144-3880166 GCCGCGGCCGGCGGCGGCGGCGG - Exonic
1133201740 16:4207899-4207921 CGCGCTGGCGGCAGACGCGGGGG + Intronic
1133223310 16:4328393-4328415 GCTGCTGCCGGTCGGGGCGGGGG + Intronic
1134433500 16:14234206-14234228 GGAGCTGCAGGCCGTGGGGGAGG - Exonic
1134656110 16:15949617-15949639 AGCGCTGGCGGCGGCGGCGGCGG - Exonic
1135517716 16:23149331-23149353 GGCGCTGCGGGATGCGGCGGCGG - Intergenic
1135537012 16:23302381-23302403 CGCGCTGTCGGCGGTGGCGGAGG - Exonic
1135712496 16:24729677-24729699 GGCGGTGTCGGCGGCGGCGGCGG + Intronic
1136022233 16:27447575-27447597 GGTGATGCTGGCTGAGGCGGTGG - Intronic
1136110890 16:28063197-28063219 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1136234317 16:28904785-28904807 GGCGCTGGAGGGCGGGGCGGTGG + Exonic
1136344184 16:29664558-29664580 GGCGCCGGCGGCAGAAGCGGCGG + Exonic
1136367744 16:29816641-29816663 GGCCTTACCGGCCGAGGCAGAGG - Exonic
1136505089 16:30698202-30698224 GGTGGTGGCGGCCGAGACGGCGG + Intronic
1136536420 16:30902403-30902425 GGCGGAGGCGGCTGAGGCGGTGG - Exonic
1136699262 16:32116710-32116732 GGCGCTGCCTGCGGAGGCGATGG + Intergenic
1136768389 16:32811224-32811246 GGCGCTGCCTGCGGAGGCGATGG - Intergenic
1136799753 16:33059881-33059903 GGCGCTGCCTGCGGAGGCGATGG + Intergenic
1136957670 16:34803903-34803925 GGCGCTGCGCGCGGAGGCGATGG + Intergenic
1137426534 16:48385263-48385285 GGCGCTGCCCGCGGTGGCGGGGG - Intronic
1137710077 16:50560339-50560361 GGAGCTGCAGCCCGAGGAGGAGG + Intronic
1138595222 16:58026079-58026101 GGCGCTGGGCGCCGAGGCTGCGG + Exonic
1139555642 16:67707988-67708010 GGCGGTGGTGGCTGAGGCGGAGG + Intronic
1140187412 16:72787702-72787724 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
1140188720 16:72796518-72796540 GGCGCTGCCGGAAGTGGGGGTGG + Exonic
1140223216 16:73058562-73058584 GGCGCTGCTGGCGACGGCGGCGG + Intronic
1140223248 16:73058688-73058710 CGCGCTGCTGGCGGCGGCGGCGG + Intronic
1140927581 16:79599193-79599215 GGCGGCGGCGGCGGAGGCGGCGG - Exonic
1141650643 16:85391093-85391115 GGGGCTGCCAGCTGGGGCGGTGG - Intergenic
1141989748 16:87602984-87603006 GGCGCGGGCGGCCGCGGCGCCGG - Exonic
1142037139 16:87869365-87869387 GGCGCCGGCGGCCGAGGAGAAGG - Exonic
1142130366 16:88429260-88429282 GGTGCTGCCGGCCGTGTTGGTGG - Exonic
1142156262 16:88534095-88534117 GGCGCGGCCGGTCGGCGCGGCGG - Exonic
1142342357 16:89531981-89532003 GACGCTGCTGGCCAAGGCGGTGG + Exonic
1142374702 16:89701070-89701092 GGCGCTGCAGGACGACGCGCTGG - Exonic
1203070781 16_KI270728v1_random:1073240-1073262 GGCGCTGCCTGCGGAGGCGATGG - Intergenic
1142515121 17:422690-422712 GGAGCTGCAGGCAGAGGCTGCGG - Intronic
1142547557 17:715120-715142 TGCGCTGCCCGCGGAGGCTGTGG - Intronic
1142850768 17:2703738-2703760 GGGTCTGCAGGCCGAGTCGGTGG - Intronic
1143034984 17:3989610-3989632 GGCCCTGCAGGCCGAGGCCCCGG - Intergenic
1143188298 17:5023699-5023721 GGCTCTGGGGGCCGGGGCGGGGG + Exonic
1143750313 17:9022394-9022416 GGCGCTGGCGGCGCTGGCGGCGG + Exonic
1144021220 17:11241262-11241284 GGCGCGGGCGGCAGTGGCGGCGG - Exonic
1144640670 17:16934918-16934940 GGCCCTGCTGACCCAGGCGGGGG - Intronic
1144775633 17:17783288-17783310 CGCGCTGCCGGCAGAGCCCGAGG + Intronic
1145980092 17:29005993-29006015 GGCGCTGGCGGCGGCAGCGGCGG - Exonic
1146403673 17:32519464-32519486 GGCTCTGGCGGCGGCGGCGGGGG + Intronic
1146403703 17:32519608-32519630 AGCGCGGCCGGCCGGGGCTGCGG - Intronic
1147158953 17:38559699-38559721 GGTGCTGCTGGCCGAGGGCGGGG + Exonic
1147257975 17:39193498-39193520 GGCCCTGCTGGCCTAGGGGGTGG + Intronic
1147382259 17:40062903-40062925 GGCTCCTCCGGCAGAGGCGGCGG - Exonic
1147406976 17:40219363-40219385 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1147659142 17:42107909-42107931 GGCGGGGCCTGCCGGGGCGGAGG - Intronic
1147943502 17:44066600-44066622 GCCGCGGCCGGCGGCGGCGGCGG + Exonic
1147971265 17:44219980-44220002 GACCCGGGCGGCCGAGGCGGAGG + Intronic
1147994606 17:44353942-44353964 GCCGCTGCTGGACGAGGTGGCGG - Exonic
1148090264 17:45019101-45019123 GGCGCGGGCGGCCCGGGCGGGGG + Intergenic
1148323253 17:46769999-46770021 GGCCACGCCGGCCGAGGCGATGG + Exonic
1148551067 17:48551100-48551122 GGCGGTGGCGGCGGCGGCGGGGG - Exonic
1148551082 17:48551139-48551161 GGCGGTGGCGGCGGCGGCGGAGG - Exonic
1149491010 17:57085308-57085330 GGCGCTGCGGGCCGGGCCGCGGG + Intronic
1150373536 17:64661979-64662001 GGCCGTGGCGGCCGAGGCGCCGG - Exonic
1150423173 17:65056607-65056629 GGAGGGGCCCGCCGAGGCGGCGG - Exonic
1150643554 17:66964865-66964887 GGCGCGGCGGGCCGGGCCGGCGG + Intergenic
1151684744 17:75639914-75639936 GGGGCTGCCGGCCAAGGCGGCGG - Exonic
1151854335 17:76710628-76710650 GGCGGCGCCAGCGGAGGCGGAGG - Exonic
1151938878 17:77280966-77280988 GGCCCCGCCGGGCGAGGCGGCGG - Intronic
1152412333 17:80133839-80133861 GGCACTGCTGGCCGAGCGGGAGG - Intergenic
1152433115 17:80260534-80260556 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433128 17:80260564-80260586 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433141 17:80260594-80260616 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433154 17:80260624-80260646 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433167 17:80260654-80260676 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433180 17:80260684-80260706 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433193 17:80260714-80260736 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433206 17:80260744-80260766 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433219 17:80260774-80260796 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152433232 17:80260804-80260826 GGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152456997 17:80422337-80422359 GGGGCTGGCGGCAGAGGCCGAGG - Intronic
1152693754 17:81733831-81733853 GGAGAAGCCGGCAGAGGCGGTGG + Intergenic
1152711205 17:81871215-81871237 GGCGGCGCCGGCGGGGGCGGGGG - Intronic
1152721912 17:81927537-81927559 GGCCCGGCGGGCCGAGGCCGGGG + Exonic
1152917972 17:83051798-83051820 GGCGCCGTAGGCCGAAGCGGCGG - Exonic
1152970686 18:158597-158619 TGCGGCGGCGGCCGAGGCGGAGG - Exonic
1153514490 18:5891374-5891396 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1153688264 18:7567453-7567475 CGAGCTGCCGGCCGTGGCCGTGG - Exonic
1154518299 18:15197742-15197764 GGCGCTGCGCGCGGAGGCGATGG - Intergenic
1156008594 18:32471016-32471038 GGCGCTGGCGGCCCCGGCCGGGG - Intergenic
1156099672 18:33578483-33578505 GGCGGTGGCGGCGGCGGCGGCGG - Intergenic
1156683075 18:39614588-39614610 GGCACTGCGGGTGGAGGCGGGGG - Intergenic
1157136680 18:45063486-45063508 GGCGGTGGCGGCAGGGGCGGCGG - Exonic
1157384296 18:47248306-47248328 GGCGGTGGCGGCGGCGGCGGCGG + Intronic
1157867200 18:51197232-51197254 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1158954118 18:62523466-62523488 GGAGCCGCCGCCCGAGGCGGAGG + Exonic
1159108070 18:64026561-64026583 GGCACCGCGGGCAGAGGCGGGGG - Intergenic
1160434708 18:78838400-78838422 AGCGCTGCCAGCCGAGATGGAGG - Intergenic
1160508842 18:79442140-79442162 AGGGCAGCGGGCCGAGGCGGTGG + Intronic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719222 19:590122-590144 GGCGTTGCCCCCGGAGGCGGCGG + Exonic
1160775521 19:853403-853425 GGTGCCGCCGGGCGGGGCGGGGG + Exonic
1160991696 19:1862902-1862924 CGCCCTGCCGGCCGGCGCGGCGG + Intronic
1161048838 19:2151424-2151446 CGCGCTGCCGGCCGCTGCGGCGG + Exonic
1161050983 19:2164042-2164064 GGCGGCGGCGGCCGAGGCCGAGG + Intronic
1161089318 19:2352258-2352280 GGCGCTGCCCGGAGGGGCGGGGG - Intronic
1161273588 19:3403829-3403851 GGGGCAGCCGGGCGCGGCGGGGG - Intronic
1161289116 19:3483376-3483398 GGGGCTGGCGGCCGAGGGGGAGG - Intergenic
1161412465 19:4124011-4124033 GGCGCTGCGGGCCTGGGCCGAGG + Exonic
1161545458 19:4877844-4877866 GGCGCTGGCGGGCGTGGGGGAGG + Intergenic
1161683350 19:5691461-5691483 GGCGCTGCCGGCCGAGGGGCGGG + Intronic
1161854220 19:6754301-6754323 GGCGCTGCGGCCAGGGGCGGCGG - Exonic
1162440090 19:10687387-10687409 GGCGGTGGCGGCGGGGGCGGTGG + Exonic
1162524122 19:11197608-11197630 GGCGGTGCCGGCTGGGGGGGCGG - Intronic
1162577162 19:11505753-11505775 GGCGCTAGAGCCCGAGGCGGAGG - Exonic
1162693476 19:12452782-12452804 AGCGCTGCCTGCTGTGGCGGGGG - Intronic
1162833107 19:13299073-13299095 CGCGCTGCTGGCCGAGGCGCTGG + Exonic
1163019317 19:14474137-14474159 GGCGCTGCTGGCGCAGGCCGCGG - Exonic
1163138815 19:15332515-15332537 TGCGCTGGCGGCGGCGGCGGCGG - Intronic
1163427066 19:17245668-17245690 TGCGCGGCCGCCCGTGGCGGGGG + Exonic
1163428127 19:17250308-17250330 GGCTCAGCAGGCCGAGGAGGTGG - Exonic
1163438462 19:17309605-17309627 GGCGGTGGAGGCTGAGGCGGCGG + Exonic
1163725151 19:18919177-18919199 GACGCTGGGGGCGGAGGCGGAGG - Intronic
1163798284 19:19349579-19349601 GGCCCTGCCTGCCCAGGCTGTGG - Intronic
1164944949 19:32285645-32285667 GGGGCTGGGGGCGGAGGCGGGGG + Intergenic
1165157408 19:33796707-33796729 GGCGGCGGCGGCGGAGGCGGCGG + Intronic
1165213698 19:34254625-34254647 GGCGCGGCGGGCGCAGGCGGGGG + Intronic
1165624324 19:37271704-37271726 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165625408 19:37276769-37276791 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165625941 19:37279294-37279316 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165626485 19:37281821-37281843 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165627024 19:37284346-37284368 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165627567 19:37286870-37286892 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165628102 19:37289394-37289416 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165628644 19:37291920-37291942 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165629184 19:37294445-37294467 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165629727 19:37296971-37296993 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165630269 19:37299498-37299520 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165630808 19:37302036-37302058 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165923795 19:39314790-39314812 GGCCCTGCCGTGGGAGGCGGTGG - Exonic
1166083276 19:40458326-40458348 GGCGCTGGGGGCCGAGGTGTAGG + Intronic
1166105741 19:40597302-40597324 GGGGCTGGCGGCGGAGGTGGCGG - Exonic
1166369685 19:42293889-42293911 GCAGCTGCAGGCTGAGGCGGGGG + Intronic
1166416247 19:42596459-42596481 GGAGCTGCCTGCAGAGGGGGCGG + Intronic
1166659105 19:44634124-44634146 GGCACTACCGGCTGTGGCGGGGG + Intronic
1166960537 19:46493763-46493785 CGCGCGGGCGGCCGAGGCCGAGG - Exonic
1167110355 19:47457114-47457136 GGCGGCGCCGGCCGAGGGCGCGG - Exonic
1167149708 19:47701765-47701787 GGTGGTGGCGGCCGTGGCGGGGG - Exonic
1167268255 19:48493891-48493913 GGCGGCGCCGGGCGCGGCGGCGG - Exonic
1167297788 19:48662006-48662028 GGTGCTAGCGTCCGAGGCGGCGG - Exonic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167569147 19:50276144-50276166 GGCGCTGCGGGGCGAGCTGGAGG + Exonic
1167743919 19:51340141-51340163 GGCGGACCCGGCCGAGGCCGCGG - Exonic
1168133817 19:54337538-54337560 GGGGCTGCCGGCCAGGGCGCTGG + Exonic
1168339514 19:55615133-55615155 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1168572635 19:57483379-57483401 GGGGCGGCTGGCCGGGGCGGGGG - Intergenic
1202680203 1_KI270712v1_random:2675-2697 GGCGCTGCCTGTGGAGGCGATGG - Intergenic
925367933 2:3323878-3323900 GGCCCTGCTGGCGGAGGCAGGGG + Intronic
925609789 2:5693142-5693164 AGCGCGGCCGGCGGCGGCGGCGG + Exonic
926095746 2:10079977-10079999 CGAGCTGCTGGCCGAGTCGGCGG - Exonic
926154865 2:10448207-10448229 GGCGCTGACGGGCGCGGCGGGGG - Exonic
926268116 2:11344472-11344494 GGCGGTCCGGGCCGCGGCGGTGG - Exonic
926275843 2:11402638-11402660 GGCGATGGCGGCAGCGGCGGTGG - Intergenic
927606503 2:24491242-24491264 GGCGGTGGCGGCGGCGGCGGTGG + Intergenic
927920797 2:26970771-26970793 GGCGGCTCCGGCGGAGGCGGAGG - Exonic
927929158 2:27033088-27033110 GGCGCCGGCGGCCGAGGAGGCGG + Exonic
928149155 2:28810749-28810771 CGCACAGCCGGCCGAGGGGGCGG - Intronic
929808493 2:45169306-45169328 GGCGCTGGAGGCCGACGGGGAGG + Intergenic
932351174 2:71033412-71033434 GGCACTTCCGGCCGGTGCGGTGG + Intergenic
932496403 2:72147857-72147879 GGCTGTGCCGGCCGCGGCGGGGG + Exonic
932621869 2:73269454-73269476 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
933886147 2:86720534-86720556 GGCTGAGGCGGCCGAGGCGGCGG - Exonic
933924034 2:87076172-87076194 GGCTGAGGCGGCCGAGGCGGCGG + Intergenic
936141574 2:109946516-109946538 GTCGCTGCCGGCTGCGGTGGTGG + Intergenic
936178262 2:110244464-110244486 GTCGCTGCCGGCTGCGGTGGTGG + Intergenic
936203118 2:110424968-110424990 GTCGCTGCCGGCTGGGGTGGTGG - Intronic
937208608 2:120252946-120252968 GGTGCGGACGGCGGAGGCGGCGG + Exonic
937954798 2:127416150-127416172 TGCGCTGCCAGCCGATGAGGCGG + Intergenic
938100174 2:128493091-128493113 GGCACTGCCCGCCGGGGCGTGGG + Intergenic
938500178 2:131828268-131828290 GACGATGCCGGCGGAGGCTGGGG + Intergenic
940774996 2:157876035-157876057 GGCGCGGCTGGCCGAGGAGCAGG + Intergenic
941008293 2:160269984-160270006 GGCGCTGCCAGCACAGGCGACGG + Intronic
941104843 2:161341008-161341030 GGCGGCGCCAGCGGAGGCGGAGG - Intronic
942453589 2:176123150-176123172 GGCGGTGCGGGCGGTGGCGGTGG + Exonic
942454905 2:176130709-176130731 GGAGGTGGCGGCGGAGGCGGAGG - Exonic
944273144 2:197805132-197805154 GGCGCCGCCCGACGCGGCGGGGG + Exonic
944801097 2:203238835-203238857 AGCGCAGCAGGCCGAGGCTGAGG - Intronic
946322248 2:218960854-218960876 GTCCCTGGCGGCCGAGGAGGCGG - Exonic
946354922 2:219178478-219178500 GGCGGCCACGGCCGAGGCGGTGG + Exonic
948140764 2:235670449-235670471 GGCGCTGCCGGCCAGGTCCGCGG - Intronic
948206942 2:236167524-236167546 GGCGCTGCAGGCTGACGCGGAGG - Exonic
948801592 2:240435772-240435794 GGCGGCGGCGGCCGAGGAGGCGG - Exonic
948874307 2:240819066-240819088 GGCCCTGCCGGCCGCAGGGGCGG - Intronic
948945887 2:241218484-241218506 GGCGCCGCCGGGCAAGGCCGGGG + Intronic
949014524 2:241702007-241702029 GGCGGTGCCGCGGGAGGCGGGGG - Intergenic
949014591 2:241702214-241702236 GGCGCGGCCGGGCGCGACGGGGG + Intronic
1169164204 20:3407985-3408007 GGCGGGGCGGGCAGAGGCGGAGG - Intergenic
1169244504 20:4015280-4015302 CGCCCGGCCGGCCGAGGCGCCGG + Intronic
1171444790 20:25195766-25195788 GGTGGCGCCGGCCGGGGCGGGGG + Exonic
1172280009 20:33701656-33701678 GGGGCGGCCGGCCGGGTCGGGGG - Intergenic
1172331162 20:34077054-34077076 GGCGCCGGCGGCGGCGGCGGTGG + Exonic
1172474456 20:35226669-35226691 CGCGCTGGCGGCCGAGGCGGCGG + Exonic
1172474550 20:35226945-35226967 GGCGCGGGCGGACGAGGCGGAGG + Exonic
1172703063 20:36864113-36864135 GGCGATGCCGGCTAAGGGGGCGG - Intergenic
1173576463 20:44115679-44115701 CGCACTGGCGGCAGAGGCGGAGG - Exonic
1173790122 20:45823047-45823069 GGCCCTGGAGCCCGAGGCGGCGG - Intergenic
1174017693 20:47502041-47502063 GGCGGTGGCGGGCGAGGGGGTGG + Intronic
1175280946 20:57803763-57803785 GGCGCTGCCTGCCGGGGTTGGGG - Intergenic
1175809761 20:61851709-61851731 GGCGCTGCCGGCAGGCGAGGGGG - Intronic
1175873684 20:62219907-62219929 GGCGCTGGCGGGCGAGGCGGCGG - Exonic
1175902944 20:62367143-62367165 GGCGCTGCTGGGCGCGGCGCGGG - Exonic
1176021053 20:62962624-62962646 GACGCTGCTGACCGGGGCGGTGG + Exonic
1176549398 21:8214744-8214766 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1176557293 21:8258973-8258995 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1176568326 21:8397778-8397800 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1176576235 21:8442008-8442030 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1176583334 21:8550553-8550575 GGCGCTGCGCGCAGAGGCGATGG + Intergenic
1178075730 21:29011952-29011974 GGCGCGGCTGGCCGGGTCGGGGG - Intronic
1178351143 21:31873671-31873693 CGCGATGCCGGCGGCGGCGGGGG + Exonic
1178498900 21:33109850-33109872 GGCGGGGCCGGCGGAGGCTGCGG - Intergenic
1178951582 21:36990126-36990148 GGCGCTGCGGGCCGGGACAGGGG - Intronic
1178992579 21:37367533-37367555 GGCGCTGGCTGCGGAGGCCGCGG + Intronic
1180051015 21:45330996-45331018 GGGGGTGCTGGCCAAGGCGGGGG + Intergenic
1180144534 21:45911977-45911999 GGCCCTGCGGGCCGAGGCTCAGG + Intronic
1180188915 21:46153579-46153601 GGCGGTGGCGGCAAAGGCGGGGG - Intronic
1180235890 21:46459164-46459186 GCCGCTGCCTGCCGAGGTGCGGG + Exonic
1180266144 22:10527483-10527505 GGCGCTGCGCGCAGAGGCGATGG + Intergenic
1180559231 22:16601991-16602013 GGCGGCGGCGGCCGCGGCGGCGG + Intergenic
1180636190 22:17264758-17264780 GCTGCTGCCGGCCGGGCCGGGGG + Intergenic
1181106874 22:20580929-20580951 GGCCCGGCAGGCCGAGGCTGGGG + Intronic
1181631884 22:24155948-24155970 GGCGCGGCCGGACGGGGCGCCGG - Intronic
1181725141 22:24806272-24806294 GGCGGTGGCGGCGGTGGCGGCGG - Intronic
1181831671 22:25564960-25564982 GGCGCGGCGGGCGGCGGCGGCGG + Exonic
1182237000 22:28883805-28883827 GGCGCAGGCGGCGGCGGCGGCGG - Exonic
1182491845 22:30677793-30677815 AGCACTGCCTGCTGAGGCGGGGG + Intergenic
1182586360 22:31346203-31346225 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1182664085 22:31944763-31944785 GGCGCGGCTGGCCGAGCAGGCGG + Exonic
1183126311 22:35784842-35784864 TGCGTTGCCGGCCGCTGCGGTGG + Intronic
1183466709 22:37983805-37983827 GGGGGAGGCGGCCGAGGCGGCGG - Exonic
1183605974 22:38866876-38866898 GGCGCTGGCGGCGGGGGCGCCGG - Exonic
1183720134 22:39557777-39557799 GGCGCTCCGGGCCGGGGCGGGGG - Intergenic
1183744791 22:39686145-39686167 GGGGCTGGCGGCGGGGGCGGCGG - Exonic
1183780233 22:39994832-39994854 GGCGAGCCCGGCGGAGGCGGCGG + Intergenic
1184568889 22:45309942-45309964 GCCGCTGCCGGCTAACGCGGAGG + Intronic
1184680773 22:46071278-46071300 GGGGCTGCGGGGCGAGGCGCGGG + Intronic
1184891057 22:47379351-47379373 GGCGGCGGCGGCGGAGGCGGCGG + Intergenic
1185248321 22:49785319-49785341 GGCCCTGCCGGCCGTGGGGCTGG - Intronic
1185301636 22:50084020-50084042 GGGGCTGCCGGCGGAGGCCAGGG + Intronic
1203254285 22_KI270733v1_random:131066-131088 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1203262341 22_KI270733v1_random:176145-176167 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
949344601 3:3065146-3065168 GGTGATGCCGGCCGCGGAGGTGG + Intergenic
949987520 3:9552690-9552712 GGCGGGGCCGGCGGCGGCGGCGG + Exonic
950940338 3:16884962-16884984 CGCGCGGCGGCCCGAGGCGGCGG + Intronic
952354385 3:32570824-32570846 GGCGGTGGCGGTGGAGGCGGCGG + Exonic
953980228 3:47409944-47409966 GGGGCTGTGGGCCGTGGCGGCGG - Exonic
954431184 3:50471637-50471659 GGTGGTGCCGGCTGAGGTGGAGG + Intronic
955161490 3:56468478-56468500 GGGGCCGGCGGCCGAGGGGGCGG + Intergenic
955769237 3:62372522-62372544 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
956978924 3:74614448-74614470 GGCGGTGGCGGCGGCGGCGGCGG - Intergenic
958900130 3:99876248-99876270 GGCGCTGTCGGCGGGGGCGCCGG + Intronic
959070213 3:101694979-101695001 GGCGCTGCCTGCTGTGGCGCGGG - Intergenic
960096639 3:113696327-113696349 GCCGCTGACAGCCGGGGCGGGGG - Intronic
961377436 3:126476063-126476085 GGCGCCGGAGGCGGAGGCGGGGG + Intergenic
961609327 3:128123971-128123993 GGCGCTTCCTGCCGAGGCTGGGG + Intronic
961735905 3:129002021-129002043 GGCGCTGCGCGCCGAGCCGCCGG + Exonic
961827174 3:129605297-129605319 GGCGGTGGCGGCGGCGGCGGCGG - Intronic
961858262 3:129893728-129893750 GGCGGTGGCGGCTGTGGCGGGGG - Intergenic
962007446 3:131362267-131362289 GGAACTGCTGGGCGAGGCGGCGG + Intergenic
962786902 3:138777082-138777104 GGTGCTGCCTGCCAAGGCTGTGG + Intronic
963733073 3:148991436-148991458 TGCGCGGCCGGCAGGGGCGGTGG - Exonic
963904468 3:150762690-150762712 CGCGGTGCCCGCCGCGGCGGCGG - Exonic
964569245 3:158094621-158094643 GGCCCTGCTGGCGGAGGCGCCGG - Intergenic
964570788 3:158105834-158105856 CGGGCGGCCGGCGGAGGCGGCGG - Exonic
965615124 3:170585611-170585633 GGAGCTGCCGGGCGGGGCGGGGG - Intronic
966883219 3:184361461-184361483 GGAGATGGCGGCCGCGGCGGCGG - Exonic
966886231 3:184379551-184379573 GGCGCTGTGGGCCCAGGCAGGGG + Intronic
966968259 3:185017743-185017765 GGCACTACCGGCTGTGGCGGGGG + Intronic
966978399 3:185106683-185106705 GGCACTACCGGCTGTGGCGGGGG - Intronic
967859717 3:194141658-194141680 GGCGCTGGGGCCCGGGGCGGGGG - Intergenic
968286196 3:197510249-197510271 CGCGCTGCCGCCCGAGCCTGAGG - Exonic
968433818 4:575193-575215 GGCGGGGCCGGCGGGGGCGGCGG - Intergenic
968434077 4:576110-576132 GGCGCAGGCGGCGGGGGCGGCGG - Intergenic
968636561 4:1684050-1684072 GGCGCAGACGGCGGAGGCAGGGG + Intronic
969413369 4:7043516-7043538 GGCGCTGACGGCCGGGGGCGCGG + Exonic
969517186 4:7654347-7654369 GGGGCTGCAGGCAGAGGCAGTGG - Intronic
969873008 4:10116435-10116457 GGCGCCGTGGGCCGAGCCGGAGG - Intronic
970823945 4:20252006-20252028 GGCGGCGGCGGCGGAGGCGGAGG + Intergenic
973317765 4:48779796-48779818 GGCGCTGCCGGCGGAACCGCCGG + Intronic
973954403 4:56049013-56049035 GGCGAAGCCGGGCGGGGCGGCGG + Intergenic
975485752 4:74933062-74933084 GGCGGCGGCGGCGGAGGCGGAGG + Intergenic
976002098 4:80386228-80386250 GGGGCTGCAGGCCGGGGCCGAGG - Intronic
976704711 4:88008110-88008132 GGAGCTCACGGCCGAGGAGGCGG - Exonic
977809943 4:101347003-101347025 GGGGCTGGCGGCAGCGGCGGAGG - Exonic
978072533 4:104491315-104491337 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
978072571 4:104491420-104491442 GGCGGCGGCGGCGGAGGCGGGGG - Exonic
978072612 4:104491497-104491519 GGCGGTGGCGGCGGCGGCGGTGG + Exonic
978381208 4:108131082-108131104 TGCTCTGGCGGCTGAGGCGGAGG - Intronic
979494988 4:121372952-121372974 GGAGCTGGCCGCCGAGGGGGAGG + Intronic
980053742 4:128061358-128061380 GGCGCAGCACGCCGAGGCCGAGG - Exonic
980541446 4:134201544-134201566 GGCGCTGCCGGCAGCGACGCGGG + Intronic
981366664 4:143912138-143912160 GGCGGCGCCGGCGGAGGTGGCGG - Intergenic
981964476 4:150583428-150583450 GACGCTGGTGGCCCAGGCGGTGG + Exonic
982042364 4:151409027-151409049 GGCGGGGCCGGCGGCGGCGGGGG + Intergenic
982198170 4:152936418-152936440 GGGTCGGGCGGCCGAGGCGGGGG + Intronic
984206467 4:176792778-176792800 GGCGCTGGCGGCGGTGCCGGGGG + Intergenic
985530212 5:429585-429607 GGCGCTGCAGGCCCAGGCCCTGG + Intronic
985643275 5:1073629-1073651 GGCTCAGCGGGCCGAGGAGGTGG - Exonic
986297080 5:6448719-6448741 GGCGCCGGCGGCTGCGGCGGCGG + Exonic
987286790 5:16465488-16465510 GGCGCAGCGGGCCGTCGCGGAGG - Exonic
988609539 5:32711858-32711880 GGCGTTGGCGGCGGCGGCGGTGG + Exonic
989379341 5:40798190-40798212 GGCGCTGCGGGAGGGGGCGGAGG + Exonic
989812572 5:45695876-45695898 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
989812575 5:45695885-45695907 GGCGGTGGCGGCGGTGGCGGCGG - Exonic
990210765 5:53480139-53480161 GGCGCTGGAGGCGGTGGCGGGGG - Intergenic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
993187233 5:84635840-84635862 GGCGCTGCCGGCGGAAGCCAGGG - Intergenic
993651649 5:90529559-90529581 GACGTTGGCGGCAGAGGCGGAGG - Exonic
994043405 5:95283917-95283939 GGCTCTGCGGGAGGAGGCGGCGG + Exonic
994043624 5:95284668-95284690 GGCGCTGGCGGTGGCGGCGGCGG + Intergenic
994043626 5:95284674-95284696 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
997304085 5:132825771-132825793 CGCGCTGGCGGCCGAGGCGGAGG - Exonic
1001159506 5:169300875-169300897 GGCGCTCCGGGCGGCGGCGGCGG + Intronic
1001470213 5:172006570-172006592 GGCGGAGGCGGCAGAGGCGGAGG + Exonic
1001688792 5:173616564-173616586 GGCGATGGCGGCAGGGGCGGTGG + Exonic
1001724884 5:173888408-173888430 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1003049418 6:2766056-2766078 CGCGCTCCCCGCCGCGGCGGCGG - Exonic
1003116180 6:3285253-3285275 GGCGCTGGCCGCCGGGGCAGTGG + Intronic
1003872901 6:10415782-10415804 GGCGCTGCGGCCCGAGGGGGTGG - Intronic
1004043935 6:12009115-12009137 GGCGGTGGCGGCGGCGGCGGCGG + Intronic
1006089678 6:31620919-31620941 GGCGGTGGCGGCGGCGGCGGCGG + Intronic
1006137089 6:31901884-31901906 GTCGCTGCCGGCCCCGGGGGGGG - Exonic
1006563049 6:34930396-34930418 GGTGCTGCCAGCCCAGGCTGTGG + Intronic
1006814253 6:36839822-36839844 GGCGCTGGCGGCGGGGGTGGCGG + Exonic
1006860767 6:37170374-37170396 GGCGCTGCCGGGACTGGCGGCGG - Exonic
1007521292 6:42453040-42453062 GGCGCAGCAGGCCGGGGAGGGGG + Intergenic
1007585166 6:42984839-42984861 GGTGCTGCCAGCCGCGGGGGCGG - Intronic
1007784199 6:44270773-44270795 AGCGCCGCCGGCGGCGGCGGCGG + Exonic
1008369189 6:50714150-50714172 GGCGGTGGCGGCGGTGGCGGCGG + Intronic
1008598388 6:53065503-53065525 CCCGTTGCCAGCCGAGGCGGGGG - Intronic
1008932470 6:56954938-56954960 GGCCCGGGCGGCCGCGGCGGCGG - Intergenic
1009431631 6:63572570-63572592 GGCGATGCAGGCGGCGGCGGGGG - Exonic
1009955441 6:70447566-70447588 GGCACTACCGGCTGTGGCGGGGG + Intronic
1010386334 6:75284735-75284757 GGCGCTGGTGGCTGCGGCGGCGG - Exonic
1011099894 6:83709051-83709073 GGCGCTGGCAGAAGAGGCGGCGG - Intronic
1011983965 6:93419147-93419169 GGCGCTGCCGGCCGCGCCTCCGG - Intronic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1013231747 6:108166706-108166728 GGCGCTGCCGGCCGGGACTCGGG + Intronic
1013272553 6:108558092-108558114 GGCGCGACCCGCCGAGGGGGCGG - Intergenic
1013792629 6:113854842-113854864 GGCGCTGCCGGCGGCCGCTGAGG - Intergenic
1014137542 6:117907194-117907216 GGCGCCGGCGGCGGCGGCGGCGG - Intergenic
1014205510 6:118651592-118651614 GGCTCTGCCGGCGGAGGGGGCGG - Intronic
1016433170 6:144008493-144008515 GGGGTCGGCGGCCGAGGCGGGGG + Intronic
1016590140 6:145735285-145735307 GGAGCTGGCGGCCGAGGAGGCGG - Exonic
1016923497 6:149317969-149317991 GGCGGCGGCGGCCGAGGAGGAGG + Intronic
1017000910 6:149996415-149996437 GGGGCTGCCTGCAGAGGAGGAGG + Intergenic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1017672310 6:156778946-156778968 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1018156650 6:160991701-160991723 GGCGGTGGCGGCGGCGGCGGCGG - Intergenic
1018613090 6:165662318-165662340 GGCGATGCTGGCGGAGGAGGAGG - Intronic
1018613379 6:165663192-165663214 GCCGCTGCCCGTGGAGGCGGTGG + Intronic
1018727875 6:166627433-166627455 GGCTCTCCCGGGCGGGGCGGTGG - Intronic
1019511487 7:1419775-1419797 GGCCCTGCCAGCAGAGGAGGTGG - Intergenic
1019989614 7:4682462-4682484 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
1020418170 7:7969309-7969331 GACGCCGCCGGCCGACACGGAGG - Exonic
1021600224 7:22356988-22357010 GGCCCTGGCCGCCGCGGCGGCGG - Intronic
1021735565 7:23637266-23637288 GGGGCGGCTGGCCGGGGCGGGGG - Intronic
1022090049 7:27102144-27102166 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1022113739 7:27246085-27246107 GCCGCTGAAGGGCGAGGCGGCGG - Exonic
1023758820 7:43444884-43444906 CGCGCTGCCGCCCTGGGCGGAGG - Exonic
1023999046 7:45178964-45178986 GGTGCTGCCGGCCGGGTCGTGGG - Intronic
1024247314 7:47480066-47480088 GGCGCCGCTGGCCGAGCCTGGGG + Intronic
1025102445 7:56146888-56146910 GGCACTACCGGCTGTGGCGGGGG - Intergenic
1025916896 7:65873261-65873283 GGCGGCGGCGGCGGAGGCGGCGG + Intronic
1029453450 7:100655544-100655566 GGGGCTGCTGGCCGCGGAGGAGG - Exonic
1029996758 7:105014165-105014187 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1030055840 7:105583160-105583182 GGCGCTGAGGGCGGGGGCGGCGG + Intronic
1033369739 7:140697143-140697165 GGCGCGGGCGGTCCAGGCGGAGG + Intronic
1033899301 7:146116209-146116231 GGAGCTGGCGGCGGCGGCGGCGG + Intergenic
1034446085 7:151115013-151115035 GGCCCCGGCGGCCGAGGCGCGGG - Intronic
1034451182 7:151138146-151138168 TGCGCTGCTGGCCGAGTGGGGGG - Exonic
1034618016 7:152435838-152435860 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1034942750 7:155242144-155242166 GGCACTACCGGCTGTGGCGGGGG + Intergenic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1035612176 8:973886-973908 GGCGGTGGCGGCGGTGGCGGAGG - Intergenic
1036711965 8:11085572-11085594 GGCACTGCTGGACGAGGAGGGGG + Intronic
1036910674 8:12755065-12755087 GGCGCTGACGGCGGCGCCGGCGG - Exonic
1037901767 8:22692966-22692988 GGCGGTGGCGGCGGTGGCGGCGG - Exonic
1038565967 8:28620265-28620287 GGCCCTGCCTGCTGAGGTGGTGG - Intronic
1038789751 8:30658020-30658042 TGGGCGGCCGGCCGAGGCGGAGG - Exonic
1038789787 8:30658138-30658160 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1039453885 8:37695810-37695832 GGCGGTGGCGGCGGCGGCGGAGG + Exonic
1040951461 8:52941468-52941490 GGCGCTGGCGGCCTCGGCAGCGG - Intergenic
1041167362 8:55102732-55102754 GGCGTCGCCGGCCCGGGCGGCGG + Exonic
1042155590 8:65841590-65841612 GGGGCTCCGGGCCGAGACGGGGG + Exonic
1042235866 8:66613025-66613047 GGCGCTGCGGGCCGGGGTCGGGG - Exonic
1043388252 8:79768308-79768330 CGCGCTGGCGGCGGCGGCGGCGG + Intergenic
1044712828 8:95073504-95073526 GGAGCAGCGGGGCGAGGCGGGGG - Intronic
1048553900 8:135457359-135457381 GGCGCGGCAGGGCGGGGCGGCGG + Intergenic
1048886483 8:138913974-138913996 GGCGGGGCTGGCCGAGGCTGCGG - Exonic
1048919323 8:139213509-139213531 GGCGCTGCAGGCCCAGGAAGAGG + Intergenic
1049093808 8:140535986-140536008 GGCGCTCCAGGCAGAGGCGCTGG + Intronic
1049109798 8:140635651-140635673 GGGGCGGCGGGCGGAGGCGGCGG + Intergenic
1049338906 8:142101427-142101449 GGCGCTGCCTTCCGAGCCAGGGG - Intergenic
1049427090 8:142542468-142542490 GGCGGTGGGGGCGGAGGCGGTGG - Exonic
1049585403 8:143430498-143430520 GGCGGTCCCGGCGGGGGCGGGGG + Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049724275 8:144138264-144138286 GGCGCTGGCGGCCGCGGAGCCGG + Exonic
1049789157 8:144465229-144465251 GGCGCTGCAGGCCCACGCGGCGG + Intronic
1050287508 9:4118319-4118341 GGCGCTGCCGGCCTACGGCGAGG - Exonic
1051206371 9:14693306-14693328 GGCGGCGCCGGAGGAGGCGGAGG - Exonic
1051855478 9:21559836-21559858 GGCGCTGGCGGCCCCGGCGGCGG - Intergenic
1052048533 9:23821697-23821719 GGCGGTGGCGGCGGCGGCGGCGG + Intronic
1052996451 9:34553835-34553857 GGGGCAGCCGGCAGGGGCGGAGG + Intronic
1053014136 9:34652208-34652230 GGCGCTGGCGGCAGCGGCCGCGG + Intronic
1054775655 9:69121687-69121709 GACACCGCCGGCCGCGGCGGCGG + Intronic
1055266311 9:74498818-74498840 GGCGGTGGCGGCGGCGGCGGCGG + Intronic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1056078195 9:83062723-83062745 GGTGCGGCCGGCCGACGCCGAGG - Exonic
1056167862 9:83956380-83956402 GCTGCTGCTGGCCAAGGCGGCGG - Exonic
1056842222 9:90007574-90007596 GGCCCTGCCCGCAGAGGCAGTGG - Intergenic
1057596127 9:96417670-96417692 GGCGGCGGAGGCCGAGGCGGCGG + Exonic
1057741075 9:97711560-97711582 GGCGCTGCCGCCAGAGGAGGGGG + Intergenic
1057869709 9:98708682-98708704 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1058058486 9:100473024-100473046 GGCGGCGCCGGCCGCGGCCGGGG + Intronic
1058885709 9:109320281-109320303 GGCGCTGCCCGCCGCGCCCGGGG - Exonic
1059492630 9:114681820-114681842 GGCGCTGCGGGCGGGGGTGGGGG + Intergenic
1059769884 9:117414954-117414976 GGTGCTGCGGGCGGCGGCGGCGG + Exonic
1060700479 9:125746553-125746575 GGCGGTGCCGGCGGCGGCGGCGG + Intergenic
1060770107 9:126326604-126326626 CGGGGTGCCGGCCGGGGCGGCGG + Intergenic
1061365785 9:130172093-130172115 GGCCCTCCCCGCCGCGGCGGGGG + Intergenic
1062366453 9:136211728-136211750 GGCCCTGGCGGCCGAGTCCGTGG - Intronic
1062499531 9:136846309-136846331 GGCGCTGCCGGCCGAGGCGGGGG - Exonic
1062499935 9:136847961-136847983 AGCGCGTCCCGCCGAGGCGGTGG + Exonic
1062556161 9:137114266-137114288 GGAGCTGGCGGCCGAGCGGGGGG - Exonic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1062592628 9:137281027-137281049 GGCGCGCCCGGCCCAGCCGGTGG + Exonic
1062619141 9:137411673-137411695 GGAGCGGCAGGCGGAGGCGGGGG + Intronic
1062653540 9:137590464-137590486 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
1203771979 EBV:54115-54137 GGAGCTGCTGACCGAGGCCGAGG - Intergenic
1203470686 Un_GL000220v1:114210-114232 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1203478507 Un_GL000220v1:158182-158204 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1203613289 Un_KI270749v1:28320-28342 GGCGCTGCGCGCAGAGGCGATGG + Intergenic
1185457721 X:319124-319146 CGCGCTGCCGGCGGGGGAGGCGG + Intergenic
1185464187 X:345645-345667 GGCGCTGCTGGAGGAGGAGGCGG - Exonic
1186496372 X:10015302-10015324 GGGGCGGCCGGCAGCGGCGGCGG + Intergenic
1186561742 X:10620252-10620274 TGCGCTGGCGGCGGAGGGGGCGG - Intronic
1188003641 X:25003220-25003242 GGCGCTCCCTTCCGAGGGGGCGG - Intergenic
1188542670 X:31266986-31267008 GGCGCTGCGGGCAGACGGGGCGG + Intronic
1189491316 X:41473548-41473570 GGTGCTGCAGGCGCAGGCGGCGG - Exonic
1189821494 X:44873415-44873437 GTCGCCGCCGCCCGCGGCGGAGG + Intronic
1190062224 X:47218932-47218954 GCCGCCGCCGGCTGAGGAGGAGG - Intronic
1190440476 X:50470578-50470600 GGCGGCGGCGGCCAAGGCGGCGG + Exonic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1192260790 X:69504968-69504990 GGCGGTGGCGGCTGCGGCGGCGG - Intergenic
1192924997 X:75747073-75747095 GGCGGTGGCGGCGGCGGCGGCGG - Intergenic
1193048728 X:77079207-77079229 GGCACTACTGGCTGAGGCGGGGG - Intergenic
1195060294 X:101187732-101187754 AGCACTGCCTGCTGAGGCGGGGG + Intergenic
1198312665 X:135436814-135436836 GGCGGCGCGGGCCGAGGCTGCGG + Intergenic
1198767089 X:140091328-140091350 GGCGGCGGCGACCGAGGCGGCGG + Intergenic
1199445112 X:147912067-147912089 GGCGGCGGCGGCGGAGGCGGCGG + Exonic
1200002596 X:153069704-153069726 GGCGGGGGCGGCCGAGGCGGGGG + Intergenic
1200005128 X:153080306-153080328 GGCGGGGGCGGCCGAGGCGGGGG - Intergenic
1200100662 X:153688033-153688055 GGCGGTGGCGGCGGCGGCGGCGG - Intronic