ID: 1062499531

View in Genome Browser
Species Human (GRCh38)
Location 9:136846309-136846331
Sequence GGCGCTGCCGGCCGAGGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 1, 2: 6, 3: 46, 4: 622}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062499531_1062499543 5 Left 1062499531 9:136846309-136846331 CCCCCGCCTCGGCCGGCAGCGCC 0: 1
1: 1
2: 6
3: 46
4: 622
Right 1062499543 9:136846337-136846359 GCCCGCGGCCCCGGGAGAGGCGG 0: 3
1: 0
2: 4
3: 43
4: 376
1062499531_1062499540 -3 Left 1062499531 9:136846309-136846331 CCCCCGCCTCGGCCGGCAGCGCC 0: 1
1: 1
2: 6
3: 46
4: 622
Right 1062499540 9:136846329-136846351 GCCGAGGAGCCCGCGGCCCCGGG 0: 1
1: 0
2: 5
3: 40
4: 292
1062499531_1062499538 -10 Left 1062499531 9:136846309-136846331 CCCCCGCCTCGGCCGGCAGCGCC 0: 1
1: 1
2: 6
3: 46
4: 622
Right 1062499538 9:136846322-136846344 CGGCAGCGCCGAGGAGCCCGCGG 0: 1
1: 1
2: 4
3: 24
4: 198
1062499531_1062499539 -4 Left 1062499531 9:136846309-136846331 CCCCCGCCTCGGCCGGCAGCGCC 0: 1
1: 1
2: 6
3: 46
4: 622
Right 1062499539 9:136846328-136846350 CGCCGAGGAGCCCGCGGCCCCGG 0: 1
1: 0
2: 5
3: 41
4: 312
1062499531_1062499542 2 Left 1062499531 9:136846309-136846331 CCCCCGCCTCGGCCGGCAGCGCC 0: 1
1: 1
2: 6
3: 46
4: 622
Right 1062499542 9:136846334-136846356 GGAGCCCGCGGCCCCGGGAGAGG 0: 3
1: 0
2: 3
3: 45
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062499531 Original CRISPR GGCGCTGCCGGCCGAGGCGG GGG (reversed) Exonic